ID: 1072809224

View in Genome Browser
Species Human (GRCh38)
Location 10:98446552-98446574
Sequence AGTCAGCAGTTCGCCGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072809216_1072809224 9 Left 1072809216 10:98446520-98446542 CCGGCCCTGCCCCTGAGTCTCTG No data
Right 1072809224 10:98446552-98446574 AGTCAGCAGTTCGCCGCCGCGGG No data
1072809213_1072809224 24 Left 1072809213 10:98446505-98446527 CCACACCTTCGGAGCCCGGCCCT 0: 1
1: 0
2: 2
3: 9
4: 141
Right 1072809224 10:98446552-98446574 AGTCAGCAGTTCGCCGCCGCGGG No data
1072809212_1072809224 25 Left 1072809212 10:98446504-98446526 CCCACACCTTCGGAGCCCGGCCC 0: 1
1: 0
2: 1
3: 20
4: 187
Right 1072809224 10:98446552-98446574 AGTCAGCAGTTCGCCGCCGCGGG No data
1072809218_1072809224 5 Left 1072809218 10:98446524-98446546 CCCTGCCCCTGAGTCTCTGGAGA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 1072809224 10:98446552-98446574 AGTCAGCAGTTCGCCGCCGCGGG No data
1072809222_1072809224 -2 Left 1072809222 10:98446531-98446553 CCTGAGTCTCTGGAGAGAGCGAG 0: 1
1: 0
2: 3
3: 15
4: 217
Right 1072809224 10:98446552-98446574 AGTCAGCAGTTCGCCGCCGCGGG No data
1072809221_1072809224 -1 Left 1072809221 10:98446530-98446552 CCCTGAGTCTCTGGAGAGAGCGA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1072809224 10:98446552-98446574 AGTCAGCAGTTCGCCGCCGCGGG No data
1072809215_1072809224 10 Left 1072809215 10:98446519-98446541 CCCGGCCCTGCCCCTGAGTCTCT 0: 1
1: 0
2: 7
3: 109
4: 847
Right 1072809224 10:98446552-98446574 AGTCAGCAGTTCGCCGCCGCGGG No data
1072809220_1072809224 0 Left 1072809220 10:98446529-98446551 CCCCTGAGTCTCTGGAGAGAGCG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 1072809224 10:98446552-98446574 AGTCAGCAGTTCGCCGCCGCGGG No data
1072809219_1072809224 4 Left 1072809219 10:98446525-98446547 CCTGCCCCTGAGTCTCTGGAGAG 0: 1
1: 0
2: 3
3: 36
4: 373
Right 1072809224 10:98446552-98446574 AGTCAGCAGTTCGCCGCCGCGGG No data
1072809214_1072809224 19 Left 1072809214 10:98446510-98446532 CCTTCGGAGCCCGGCCCTGCCCC 0: 1
1: 0
2: 4
3: 54
4: 501
Right 1072809224 10:98446552-98446574 AGTCAGCAGTTCGCCGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072809224 Original CRISPR AGTCAGCAGTTCGCCGCCGC GGG Intronic
No off target data available for this crispr