ID: 1072810936

View in Genome Browser
Species Human (GRCh38)
Location 10:98461247-98461269
Sequence GATCCAGGCCTGGCCCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072810929_1072810936 30 Left 1072810929 10:98461194-98461216 CCAGAGATAAGTGTGTTGTAAAT 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1072810936 10:98461247-98461269 GATCCAGGCCTGGCCCCACATGG No data
1072810932_1072810936 3 Left 1072810932 10:98461221-98461243 CCCAATGGAGAGCTAGGCAGAGA 0: 1
1: 0
2: 2
3: 28
4: 245
Right 1072810936 10:98461247-98461269 GATCCAGGCCTGGCCCCACATGG No data
1072810933_1072810936 2 Left 1072810933 10:98461222-98461244 CCAATGGAGAGCTAGGCAGAGAA 0: 1
1: 0
2: 2
3: 30
4: 239
Right 1072810936 10:98461247-98461269 GATCCAGGCCTGGCCCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072810936 Original CRISPR GATCCAGGCCTGGCCCCACA TGG Intronic
No off target data available for this crispr