ID: 1072814262

View in Genome Browser
Species Human (GRCh38)
Location 10:98489226-98489248
Sequence AAAATCCATCTGGCCAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072814262_1072814273 20 Left 1072814262 10:98489226-98489248 CCATATTTGGCCAGATGGATTTT 0: 1
1: 0
2: 0
3: 17
4: 246
Right 1072814273 10:98489269-98489291 CTGATTATAGTTTTCCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072814262 Original CRISPR AAAATCCATCTGGCCAAATA TGG (reversed) Intronic
900072587 1:784621-784643 AGATTCCAACAGGCCAAATATGG + Intergenic
902370320 1:16002651-16002673 AAAGTCCCTTTTGCCAAATAAGG + Intergenic
907365605 1:53956942-53956964 AAAATACATCTGAGTAAATAAGG + Intronic
907954932 1:59218992-59219014 AAAGACCATATGTCCAAATAAGG + Intergenic
909043093 1:70676924-70676946 AAAATCCATTTTGCCATCTATGG + Intergenic
909195341 1:72614431-72614453 AAAAATCATCTAACCAAATATGG + Intergenic
909602284 1:77473038-77473060 AAAATCCCTTTGGCCATGTAAGG + Intronic
911202151 1:95056266-95056288 AATTTCCATATGGCAAAATAGGG - Intronic
911234295 1:95394226-95394248 AATATCCATTTGGCCCAGTATGG + Intergenic
916925602 1:169517325-169517347 AAACTCATTCTGGCCCAATATGG - Intronic
917345024 1:174021595-174021617 GAAATCCACTTGGCCAAAGAAGG + Intronic
917591965 1:176485515-176485537 AAAATATATATGTCCAAATATGG - Intronic
920725612 1:208432144-208432166 AAGATCCTTCTGGACAAATTGGG - Intergenic
921519027 1:216136626-216136648 AAAATCCCTATTTCCAAATAAGG - Intronic
922268169 1:224007545-224007567 AGATTCCAACAGGCCAAATATGG + Intergenic
1062991734 10:1825643-1825665 AAAATCCCTTTTGCCACATAAGG + Intergenic
1063654067 10:7969666-7969688 AAAATCCATCTGTCAAAGTGGGG + Intronic
1063702182 10:8395099-8395121 AGAATCTCTCTGCCCAAATAAGG - Intergenic
1066784047 10:38982371-38982393 AAAATACATCTGATCAAACAAGG - Intergenic
1070280654 10:75045817-75045839 AAGATCAATCTGGCCAGACAAGG + Intronic
1070351490 10:75597072-75597094 AAAAACTCTCTAGCCAAATAAGG - Intronic
1070516075 10:77208147-77208169 AAAATCCACCAGAACAAATAAGG - Intronic
1071415875 10:85440984-85441006 AAAAGCCTTCTTTCCAAATATGG - Intergenic
1072154515 10:92712441-92712463 AACATCCATCTGAAGAAATAAGG - Intergenic
1072814262 10:98489226-98489248 AAAATCCATCTGGCCAAATATGG - Intronic
1073179769 10:101576744-101576766 AAAGTCCCTCTAGCCAACTAAGG + Intronic
1074682374 10:115920547-115920569 AGAATCCATCTAGCCAGATCTGG + Intronic
1077454402 11:2669790-2669812 AAAAGCTCTCAGGCCAAATAAGG - Intronic
1078801608 11:14650491-14650513 AAAGTCCATTTTGCCACATAAGG - Intronic
1079369883 11:19842418-19842440 AATATTAATCTGGCCAAAGATGG + Intronic
1079911351 11:26314485-26314507 AAAATTCCTGTGGCCAAAAATGG + Intronic
1079979159 11:27131096-27131118 AGAATCCATACTGCCAAATAAGG - Intergenic
1081368743 11:42271920-42271942 AAAATGCATTTGCCCATATATGG - Intergenic
1081905538 11:46667213-46667235 AAAAGTCCTCTGGCCAAAAACGG - Intronic
1085980020 11:81713441-81713463 AAAGTCCATATTTCCAAATAAGG + Intergenic
1086862936 11:91946570-91946592 AGAAACCATCTGGCCCAACAGGG + Intergenic
1087260338 11:96003522-96003544 AAAATCCCTCTGTTCAAAAAGGG + Intronic
1087956750 11:104297901-104297923 AGAATCCATTTGGAAAAATAAGG - Intergenic
1091595210 12:1873833-1873855 AAAATCAGTCTGGCCTAAAAGGG + Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092412355 12:8263495-8263517 AAAGTCCATCTGGCCAGGCACGG - Intergenic
1093669559 12:21857538-21857560 AAAATCCTGCTGGACATATAAGG - Intronic
1093853037 12:24064250-24064272 TAAATGAATCTAGCCAAATATGG - Intergenic
1095196584 12:39325629-39325651 AAAATTTCTCTGGCCAGATACGG - Intronic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1098460855 12:70731600-70731622 AAAAACCAATTGGCCACATAGGG + Intronic
1099010391 12:77284714-77284736 AAAATCCATCTGGATAATGATGG - Intergenic
1100157014 12:91811878-91811900 AAAATCCATCTGGCCACCAGGGG + Intergenic
1101430318 12:104621456-104621478 AAAGTCCCTTTTGCCAAATAAGG - Intronic
1101876713 12:108600845-108600867 CAAATCCCTTTTGCCAAATAAGG + Intergenic
1102940137 12:116933565-116933587 CAAATCCAACTGGCCATAGAGGG - Intronic
1106197538 13:27507271-27507293 GAAATCCATCTGGAAAAATTTGG + Intergenic
1107007569 13:35631537-35631559 AAACTCCATCTAGCCTAAGATGG + Intronic
1107626443 13:42290715-42290737 GAATTCCCACTGGCCAAATATGG - Intronic
1107758114 13:43647746-43647768 AAAATCTATTTTGCCATATAAGG - Intronic
1107771885 13:43795725-43795747 TTAATCCTTCTGGTCAAATATGG - Intergenic
1109269640 13:60240502-60240524 AAAATACATCAGGTAAAATAAGG - Intergenic
1109511133 13:63376127-63376149 AAAATATGTCTTGCCAAATATGG + Intergenic
1111315494 13:86552956-86552978 AAAGACCATCTTTCCAAATAAGG + Intergenic
1116166530 14:41340981-41341003 AAAATCCATGTGACCAAGAATGG + Intergenic
1119228940 14:72965059-72965081 AGAATCCAACTGGCCCAACATGG + Intergenic
1119598934 14:75961525-75961547 AAAGGCCATTTAGCCAAATAAGG + Intronic
1120836508 14:89042553-89042575 AAAATCCTTTTTGCCATATAGGG - Intergenic
1121364587 14:93297018-93297040 AAAATCTATCTGACTAAATGGGG + Intronic
1122294710 14:100698818-100698840 AAAAACCCTCTTTCCAAATAAGG - Intergenic
1123837683 15:24212545-24212567 CATATCCAACTGGCTAAATAAGG + Intergenic
1123847214 15:24314857-24314879 CATATCCAACTGGCTAAATAAGG + Intergenic
1123866211 15:24521924-24521946 CATATCCAACTGGCTAAATAAGG + Intergenic
1125382648 15:39103562-39103584 AAATTCCTTCTGCCCATATAAGG + Intergenic
1125457015 15:39870287-39870309 AAAATCCCTTTTGCCATATAAGG + Intronic
1126300679 15:47192525-47192547 ACAATACATCTGCCCAAAGATGG + Intronic
1129521764 15:76190704-76190726 AAAATCAATCTGGTCAAAGCAGG - Intronic
1129967901 15:79753142-79753164 AGAATCCAACTGGCCCAACATGG + Intergenic
1133353621 16:5119731-5119753 AAAGTCCATCTGGCCAGGTGCGG - Intergenic
1137311659 16:47266855-47266877 AAATTCTATTTGGCCAAAAAAGG + Intronic
1138051976 16:53788313-53788335 CCACCCCATCTGGCCAAATAAGG - Intronic
1138613794 16:58148322-58148344 AAAAACCTTCTTTCCAAATAAGG + Intergenic
1138929878 16:61639946-61639968 AAAATCCCTCTGATCAATTAAGG - Intergenic
1141269216 16:82523481-82523503 AAAATCCCTTTTGCCACATAAGG + Intergenic
1141317024 16:82972047-82972069 AAAATCCATCTGTACATATCTGG - Intronic
1141329960 16:83101950-83101972 AAAGTCTATTTGGCCATATAAGG - Intronic
1143889666 17:10092975-10092997 AAAATCCGTCTTGCCATATAAGG + Intronic
1144166323 17:12614484-12614506 AAAATCAATCTTGCCAGAAAGGG + Intergenic
1145860930 17:28209303-28209325 AAGCTCCCTCTGGCCAAAGATGG - Intergenic
1148255264 17:46125529-46125551 CAAATACATCTGTCCATATAGGG + Intronic
1149504321 17:57181358-57181380 AAAATGCATCTGGCTACATGTGG - Intergenic
1151800666 17:76377572-76377594 AAAATCCCTCTTGCCATATAGGG - Intronic
1153889321 18:9497916-9497938 AAACTCCCACTGGCCAAAGATGG - Intronic
1155426341 18:25711511-25711533 AAAGTCCATCGGGCCAGACAGGG - Intergenic
1155650618 18:28136699-28136721 AAAATCCATCTAGACTAATATGG + Intronic
1156234717 18:35191175-35191197 AAAATCCATATGGTAAGATAGGG - Intergenic
1157117985 18:44880406-44880428 AAAATGCAGCTGGCTAAATTTGG + Intronic
1157974566 18:52312378-52312400 TAAATCCATCTAGGCACATAAGG - Intergenic
1158107404 18:53901425-53901447 GAAATTCATCTGGACAAAAATGG - Intergenic
1159421382 18:68225111-68225133 AAAATCCCTTTAGCCACATAAGG - Intergenic
1166904793 19:46100662-46100684 AATATCCTTGTGGGCAAATATGG + Intergenic
1167285736 19:48598060-48598082 AAAATCCCTTTTGCCACATAAGG + Intronic
1167401882 19:49278259-49278281 AAAAGCCATTTGGCAAAATGCGG + Intergenic
1167800314 19:51736359-51736381 AAAACCCCTCTTTCCAAATAAGG - Intergenic
927498853 2:23568626-23568648 AAAATCCCACTGGCCAAAGCAGG + Intronic
927934906 2:27070942-27070964 AAAAAAAATCTGCCCAAATAAGG + Intronic
928217786 2:29376757-29376779 AAAATCCAGCTGGGTAAATGAGG - Intronic
928737463 2:34308772-34308794 AAAATACATGTGGTCAATTAAGG - Intergenic
928890449 2:36197709-36197731 AAAGTCCATTTTGCCATATAAGG - Intergenic
929163219 2:38854437-38854459 ATAATCCATTTAACCAAATAAGG - Intronic
929415310 2:41741269-41741291 AAAATCCATTTGCCCAAAGAAGG - Intergenic
932481667 2:72043171-72043193 ATAATCCATTTGGCCAAGAATGG + Intergenic
934030458 2:88041028-88041050 TAAATCCAAATGTCCAAATAAGG - Intronic
934767888 2:96890532-96890554 AGAAAACATCTGGCCAGATATGG + Intronic
935729215 2:106051188-106051210 AAAATCCAACCAGCCAAACAAGG - Intergenic
935960868 2:108424314-108424336 AAAATCTATCTGGCCAGGCATGG + Intergenic
936704975 2:115061343-115061365 AAAAGCCATTTGGCCAATTTTGG - Intronic
938588113 2:132711755-132711777 AAACTCAATTAGGCCAAATAAGG + Intronic
938700086 2:133869654-133869676 AAATTCCAACTGGAAAAATACGG + Intergenic
939483894 2:142784297-142784319 AAAATCTATCCTGCCAACTAGGG - Intergenic
941069846 2:160943623-160943645 AAAATCAATGTGGACAAGTATGG - Intergenic
941974776 2:171391572-171391594 AATATCTATCTTTCCAAATAGGG + Intronic
942520985 2:176803707-176803729 AGGATCCAACTGGCCAAAGATGG + Intergenic
942807489 2:179949393-179949415 AAAATCCAAATGGCCAATAATGG + Intronic
944420380 2:199523834-199523856 AAAATTCATCTGGACAGATTTGG - Intergenic
944984909 2:205165409-205165431 AAAATCATTCTGGAAAAATATGG - Intronic
945835310 2:214832831-214832853 AAATGCCACCTGGCCAAATTTGG - Intergenic
947920275 2:233864908-233864930 AGAATCCATCTGGACACTTACGG + Intergenic
948051685 2:234983587-234983609 AAAGTCCCTTTTGCCAAATAAGG - Intronic
1173129071 20:40370674-40370696 AAAAACCATTTGGCCAAACTAGG + Intergenic
1174575397 20:51533502-51533524 AAATTCCATCTGGATAAATCAGG + Intronic
1176934747 21:14853572-14853594 AAAGTCCCTCTTGCTAAATAAGG - Intergenic
1182210720 22:28674901-28674923 AAAATCCATTTGGAAATATAAGG + Intronic
1183570437 22:38649272-38649294 AAAATGTATCTGGCCAGATGCGG + Intronic
1185079444 22:48701614-48701636 AAAGTCCAACTTGCCAAAAACGG - Intronic
950585196 3:13887262-13887284 ACCATCCATCTGCTCAAATAAGG + Intergenic
951208726 3:19950919-19950941 AAGACCCAACGGGCCAAATACGG + Exonic
952161577 3:30699023-30699045 AAAATCCATTTTTCCAAATAAGG + Intergenic
952180600 3:30912706-30912728 AAAGTCCCTTTTGCCAAATAAGG + Intergenic
952860477 3:37808342-37808364 AGAATCCACCTGGCCCAATGTGG + Intronic
953514973 3:43581553-43581575 ATATTCCATCTCCCCAAATATGG - Intronic
957671470 3:83308334-83308356 AAAATCCATCTGCCATAATAAGG - Intergenic
957943412 3:87033916-87033938 AAAATCCCTTTTGCCACATAAGG - Intergenic
958130463 3:89413541-89413563 AAAACCTATTTGGCTAAATAAGG + Intronic
958571890 3:95894660-95894682 AAAACACATCTGCCCAACTAGGG - Intergenic
961295886 3:125884007-125884029 AAAGTCCATCTGGCCAGGTGCGG + Intergenic
961889916 3:130122157-130122179 AAAGTCCATCTGGCCAGGCACGG - Intergenic
962490653 3:135890832-135890854 AAAATGCATATGGCCACAGAGGG + Intergenic
963098381 3:141571604-141571626 AAAATCAATCTGTCAAACTAAGG - Intronic
963413720 3:144966147-144966169 AATATATATATGGCCAAATATGG - Intergenic
964123584 3:153211997-153212019 AAAATCAATCAGCCTAAATAAGG + Intergenic
964797830 3:160519058-160519080 AAAATCCATATGGAAATATAAGG - Intronic
965344766 3:167534671-167534693 AAAATTCAGCTGTCAAAATATGG + Intronic
965795066 3:172431082-172431104 AAAATACATCTGTACAAACAAGG - Intergenic
966476625 3:180356075-180356097 AAAAACCTTATTGCCAAATAAGG + Intergenic
969000397 4:3976133-3976155 AAAGTCCATCTGGCCAGGCATGG - Intergenic
969753625 4:9132532-9132554 AAAGTCCATCTGGCCAGGTACGG + Intergenic
972184044 4:36506494-36506516 AGAGTCCATTTGGACAAATATGG + Intergenic
973589050 4:52421972-52421994 ATAATCCAGCTGTCCAAACATGG - Intergenic
974581080 4:63802306-63802328 AAAATGCATTTGCCCACATAAGG - Intergenic
975497315 4:75048863-75048885 AAGATACATTTGGCAAAATAAGG - Exonic
975622840 4:76310925-76310947 ACAGTCCATCTGGCCAGATGCGG - Exonic
975775460 4:77781635-77781657 AAAAACAAGCTGGCCAAATCAGG + Intronic
978884947 4:113757752-113757774 AGATTCCATCAGGCCAAAGAAGG + Intronic
979451855 4:120881911-120881933 ACAATCCCTCTGACCAAAAATGG + Intronic
980085302 4:128384322-128384344 AAACATCTTCTGGCCAAATATGG + Intergenic
980615769 4:135223043-135223065 AACTTCCATCTTGCCAAATCTGG + Intergenic
981317321 4:143351925-143351947 ACAATCCAACTGGCAACATAGGG - Intronic
982877710 4:160668246-160668268 AAAATATATCTGTCCAAAGAAGG + Intergenic
984709379 4:182872416-182872438 AAAGTCCATTTTGCCACATAAGG + Intergenic
986141545 5:5035235-5035257 GAAATCCATATGGCAACATATGG - Intergenic
986503386 5:8425487-8425509 AAAATCCATTTAGGCAAATCAGG + Intergenic
986515933 5:8563789-8563811 AAAATCCATTTGGACACATCAGG + Intergenic
986799533 5:11245327-11245349 AAAGTCCATTTGGCCATAGAAGG - Intronic
987022823 5:13892337-13892359 AAAATCCCTTTTGCCATATAAGG - Intronic
987841103 5:23223610-23223632 AAAAACCCTGTGTCCAAATAAGG - Intergenic
988625812 5:32873186-32873208 AAAGTCCCTATGCCCAAATATGG + Intergenic
989332459 5:40275792-40275814 AAAGACCATTTTGCCAAATAAGG + Intergenic
989385860 5:40854106-40854128 CAAATCCAGCTCTCCAAATAGGG + Exonic
989987080 5:50713661-50713683 AAATTCCTTTTGGCCATATAAGG - Intronic
990611249 5:57459051-57459073 AAAATCCATTTTGCCAGGTAAGG - Intergenic
991388152 5:66113084-66113106 AAAAATCATTTGACCAAATATGG - Intergenic
992712975 5:79479310-79479332 AAAATCCCTTTTGCCAAATAAGG - Intronic
992819731 5:80484357-80484379 AAAATCCATCTGGCCAGGCATGG - Intergenic
993315792 5:86404475-86404497 AAAATCCTTTTGGTCATATAAGG + Intergenic
993538429 5:89117717-89117739 CAAAATCATCTGGCAAAATAGGG + Intergenic
993750645 5:91662353-91662375 AAACTCCTTCTGGCAAAAGAAGG - Intergenic
997204112 5:132031591-132031613 TAAATCCTTCTGGCCAAGAAGGG - Intergenic
997573877 5:134957802-134957824 AAAATCCATTTGACCATGTATGG - Intronic
997606998 5:135182390-135182412 AAAATCCATCAGGGTAACTATGG - Intronic
999206611 5:149852947-149852969 AAAATCCAACTGCCCAAATTTGG + Exonic
1000201580 5:159015982-159016004 AAAATCCATATGCCCATATCTGG + Intronic
1000258608 5:159564486-159564508 AAAATCCAGCTGACAAATTAAGG - Intergenic
1001218292 5:169876254-169876276 AAAGTCCCTTTTGCCAAATAAGG + Intronic
1004975686 6:20963637-20963659 AAAATACACCTGGCACAATAAGG - Intronic
1005658963 6:27974538-27974560 AAAATACATTTGGCAACATAGGG - Intergenic
1005991111 6:30902784-30902806 AAAATCCTTCTGGCCAAGGTTGG + Intergenic
1006374514 6:33664566-33664588 AAAATTCATTTGGACAAATGAGG - Intronic
1006917919 6:37607724-37607746 AAAATCCCTATTTCCAAATAGGG + Intergenic
1007068693 6:39018833-39018855 AAAATCCATCTGGCCATTTTTGG - Intronic
1007688923 6:43685390-43685412 AAGAACCATCTGGCCCAAAATGG - Intronic
1008395565 6:51002897-51002919 AAAATTAATCTGGCAATATAGGG - Intergenic
1008936247 6:56995763-56995785 AAAAACCCTATGTCCAAATAAGG + Intronic
1009913587 6:69964610-69964632 AAAATCCTTGAAGCCAAATACGG - Intronic
1010597450 6:77781186-77781208 AAAGTAAATCTGGCCAGATATGG - Intronic
1011051463 6:83155312-83155334 AAAATTAAACTGGCCAAATGTGG + Intronic
1011847708 6:91587182-91587204 AAATTACAGCTGGGCAAATATGG - Intergenic
1012155715 6:95817634-95817656 TAAAACCATCTGGCCAATAAGGG + Intergenic
1013339474 6:109199351-109199373 CAGATCCACCTGGCCAAGTAGGG + Intergenic
1013380106 6:109560105-109560127 AAAATCCTTTTTGCCATATAAGG + Intronic
1013458418 6:110353504-110353526 AAAAACCATATGGCAAAATTTGG - Intronic
1015275739 6:131381831-131381853 AAAATCCATCTGGGAAATTAGGG - Intergenic
1015325305 6:131917719-131917741 AAAAGCCATCTCTCCAAACATGG - Intergenic
1015523657 6:134155309-134155331 TAAATCCAATTGGCTAAATAAGG - Intergenic
1017283624 6:152650064-152650086 AAAATCCATCTGGCAACCAACGG + Intergenic
1017828592 6:158102581-158102603 AAGATCAGCCTGGCCAAATATGG + Intergenic
1019638825 7:2091483-2091505 AAGATCCATCTGGCCGGACACGG + Intronic
1021022526 7:15621407-15621429 GAACTTCATCTGGCCAAAGAAGG - Intronic
1022055530 7:26729539-26729561 AAAATGAAACTGGCAAAATAAGG + Intronic
1022981313 7:35607304-35607326 AAAATCCATGTGGCAAAAGTAGG + Intergenic
1023435884 7:40140192-40140214 AAAATCAATTTGGCCAGACACGG - Intronic
1023613504 7:41995057-41995079 AAAATCCAGGTGGCAAAATTTGG - Intronic
1024209926 7:47194402-47194424 AAAATCCCTATTTCCAAATAAGG - Intergenic
1027673516 7:81131144-81131166 AAAATCCATGTAGCCCAAAAAGG + Intergenic
1028268225 7:88755354-88755376 AAAAACCATATTTCCAAATAAGG + Intergenic
1030624713 7:111831777-111831799 AAAATGCATTTGGCCAGACACGG - Intronic
1030908408 7:115214831-115214853 AAAATCCCTATTGCCATATAAGG + Intergenic
1030998356 7:116385764-116385786 AAAAGCCATGTGGCCAAGCACGG + Intronic
1032181634 7:129684091-129684113 AAACTCCATCTAGCTAAAGAAGG + Intronic
1032342245 7:131085452-131085474 AAACTCCTACTGGCCAAATCTGG + Intergenic
1036376838 8:8207864-8207886 AAAGTCCATCTGGCCAGGCACGG + Intergenic
1036852699 8:12215273-12215295 AAAGTCCATCTGGCCAGGCACGG - Intergenic
1036874070 8:12457795-12457817 AAAGTCCATCTGGCCAGGCACGG - Intergenic
1037297679 8:17418361-17418383 AAAATGCATCTGCCCTGATATGG - Intergenic
1038330975 8:26609205-26609227 AAAATCCTTCTGTACAAATATGG - Intronic
1038925915 8:32139201-32139223 AAATTTCATCTGGCAAAAAAAGG - Intronic
1038952898 8:32435030-32435052 AAAATCCACCTGGGAAAACATGG - Intronic
1040276230 8:46015453-46015475 AAAATCCACATGGCCAAGGAGGG - Intergenic
1042156539 8:65850338-65850360 AAAATCCATCTGTTTAATTAAGG + Intergenic
1043432082 8:80204963-80204985 AAATTCCCACTGGCCAAATCCGG + Intronic
1043498691 8:80831334-80831356 ATACTTCATCTGTCCAAATAGGG + Intronic
1045483022 8:102608210-102608232 AAAAACCTTTTGTCCAAATAAGG - Intergenic
1048205040 8:132408600-132408622 AAAATCCTTTTGGCCACATAAGG - Intronic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1048956382 8:139540392-139540414 AACATAGATTTGGCCAAATAGGG + Intergenic
1050627934 9:7525829-7525851 AAGCTCCAACTGGCCAAATGTGG - Intergenic
1051798629 9:20905579-20905601 TAAATCCAGCTGTCAAAATAGGG + Intronic
1052416482 9:28184493-28184515 AAAATCCTACTGGACAAGTATGG + Intronic
1052870095 9:33497023-33497045 AAAATGGAGCTGGCTAAATAAGG + Intergenic
1053214767 9:36261213-36261235 AAAGTCCCTCTTGCCAAGTAAGG + Intronic
1055844344 9:80543568-80543590 AAAATTCATTTTGCCATATAAGG - Intergenic
1057300082 9:93873023-93873045 AAAATCCATCTTGGCATGTAAGG + Intergenic
1057688305 9:97258049-97258071 AAAATGGAGCTGGCTAAATAAGG - Intergenic
1057892355 9:98878953-98878975 AAAGTCCTTCTGGCCAGATGTGG - Intergenic
1058553352 9:106139299-106139321 AAAATCCCTATTTCCAAATAAGG - Intergenic
1060111314 9:120908848-120908870 AAAAACCATCTGGCCAGGCATGG - Intronic
1061343893 9:130006292-130006314 AAAATCCATCTTGACCAACATGG + Intronic
1185831666 X:3309212-3309234 AAACTCCAGCTTGCCCAATAAGG - Exonic
1186166728 X:6834563-6834585 AAAGTCCTTCTGGCCATGTAAGG - Intergenic
1188595854 X:31899352-31899374 AAAATGAATATGGCCAAAAATGG - Intronic
1190975189 X:55392489-55392511 AAAATCCATCTACCCAAAGGAGG + Intergenic
1192757815 X:74065317-74065339 AAAATCTCACAGGCCAAATATGG - Intergenic
1192901577 X:75504097-75504119 AAAGACCATCTTTCCAAATAAGG + Intronic
1193798925 X:85912619-85912641 AAAGTCCTTCTTGCCAGATATGG - Intronic
1194116634 X:89907452-89907474 ACAATCTATATGGCAAAATATGG + Intergenic
1196588299 X:117456324-117456346 AAAATCCCTATGTCCAAATAAGG + Intergenic
1197409869 X:126103549-126103571 AAAATCCATGGAGCAAAATAGGG + Intergenic
1200469432 Y:3564624-3564646 ACAATCTATATGGCAAAATATGG + Intergenic
1201244333 Y:11987867-11987889 AAACTCCAGCTTGCCCAATAAGG + Intergenic