ID: 1072816558

View in Genome Browser
Species Human (GRCh38)
Location 10:98515125-98515147
Sequence GTGGTCAAGCCGACTGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072816555_1072816558 2 Left 1072816555 10:98515100-98515122 CCAGGGAATCTGAAAGCTGGGTG 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1072816558 10:98515125-98515147 GTGGTCAAGCCGACTGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072816558 Original CRISPR GTGGTCAAGCCGACTGAGAG TGG Intronic
No off target data available for this crispr