ID: 1072816558 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:98515125-98515147 |
| Sequence | GTGGTCAAGCCGACTGAGAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072816555_1072816558 | 2 | Left | 1072816555 | 10:98515100-98515122 | CCAGGGAATCTGAAAGCTGGGTG | 0: 1 1: 0 2: 0 3: 19 4: 227 |
||
| Right | 1072816558 | 10:98515125-98515147 | GTGGTCAAGCCGACTGAGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072816558 | Original CRISPR | GTGGTCAAGCCGACTGAGAG TGG | Intronic | ||
| No off target data available for this crispr | |||||