ID: 1072818799

View in Genome Browser
Species Human (GRCh38)
Location 10:98536032-98536054
Sequence TCTTATATGCAGACAAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072818792_1072818799 0 Left 1072818792 10:98536009-98536031 CCCTCATTAACCTCACAGCCCCC No data
Right 1072818799 10:98536032-98536054 TCTTATATGCAGACAAAAGATGG No data
1072818793_1072818799 -1 Left 1072818793 10:98536010-98536032 CCTCATTAACCTCACAGCCCCCT 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1072818799 10:98536032-98536054 TCTTATATGCAGACAAAAGATGG No data
1072818794_1072818799 -10 Left 1072818794 10:98536019-98536041 CCTCACAGCCCCCTCTTATATGC 0: 1
1: 0
2: 1
3: 12
4: 128
Right 1072818799 10:98536032-98536054 TCTTATATGCAGACAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072818799 Original CRISPR TCTTATATGCAGACAAAAGA TGG Intronic
No off target data available for this crispr