ID: 1072822035

View in Genome Browser
Species Human (GRCh38)
Location 10:98567788-98567810
Sequence GAGGCAAGTGCTACACAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072822035_1072822040 4 Left 1072822035 10:98567788-98567810 CCAAATTGTGTAGCACTTGCCTC 0: 1
1: 0
2: 1
3: 4
4: 92
Right 1072822040 10:98567815-98567837 TGGAGACAGTAATAAATCAGGGG No data
1072822035_1072822038 2 Left 1072822035 10:98567788-98567810 CCAAATTGTGTAGCACTTGCCTC 0: 1
1: 0
2: 1
3: 4
4: 92
Right 1072822038 10:98567813-98567835 ACTGGAGACAGTAATAAATCAGG No data
1072822035_1072822039 3 Left 1072822035 10:98567788-98567810 CCAAATTGTGTAGCACTTGCCTC 0: 1
1: 0
2: 1
3: 4
4: 92
Right 1072822039 10:98567814-98567836 CTGGAGACAGTAATAAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072822035 Original CRISPR GAGGCAAGTGCTACACAATT TGG (reversed) Intronic
901130033 1:6956558-6956580 AAGGCAACAGCTGCACAATTAGG + Intronic
903731486 1:25499334-25499356 GAGGCAAGTGCAAAACACTGTGG - Exonic
906010959 1:42525569-42525591 GAAACAAGTGCAACACAACTAGG - Intronic
907824964 1:58006865-58006887 TATGCAAATGCTACACAAATTGG + Intronic
907990061 1:59572176-59572198 GAGCCAAGTGCCATATAATTTGG + Intronic
910674488 1:89802844-89802866 GAGGCCAGTGCTACAAAAACAGG - Intronic
915922208 1:159984870-159984892 GAAGCAAGCCCTACACATTTAGG + Intergenic
916071150 1:161170704-161170726 GAAGCAGCTGCTACACAATTAGG + Exonic
924730566 1:246707724-246707746 TAGGCAAGTGTTTCAAAATTTGG + Intergenic
1063007899 10:1992157-1992179 GAGCTAAGTGCTACATAATAAGG + Intergenic
1064765540 10:18667258-18667280 GAGGTAAGAGCCACACAATGGGG - Intronic
1072822035 10:98567788-98567810 GAGGCAAGTGCTACACAATTTGG - Intronic
1073947311 10:108765943-108765965 GAGCCAAGTGCTACAGCCTTGGG + Intergenic
1077748154 11:4932256-4932278 GGGGCAATTGATACATAATTTGG - Intronic
1082696710 11:56375906-56375928 GATGCATGTGCTACTCAACTGGG + Exonic
1090878428 11:130812232-130812254 AAGGCAAGTGAAAAACAATTGGG + Intergenic
1095523849 12:43101385-43101407 GGGGCAAGAGCTAAACTATTTGG + Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095760572 12:45830406-45830428 TAGGCCAGTGGTACAAAATTTGG + Intronic
1097070001 12:56347819-56347841 AAGCCAAATGCTACACAAGTTGG + Intronic
1098855119 12:75644048-75644070 GAGGAAAGTCATTCACAATTTGG + Intergenic
1103766880 12:123286610-123286632 GGGGCAAGGGCCACACTATTGGG - Intergenic
1105577434 13:21667347-21667369 GAGGGCAGTGTTACACAATGAGG + Intergenic
1105873230 13:24528966-24528988 GAGGGAAGTGCTGATCAATTGGG - Intergenic
1110645409 13:77877690-77877712 GGGCCAAGTACCACACAATTAGG - Intergenic
1115058263 14:29157477-29157499 AAGGCAACTGTTACATAATTTGG - Intergenic
1115888237 14:37998016-37998038 GAGGAAAGTGCTTTCCAATTAGG + Intronic
1119533141 14:75377530-75377552 GAGGAAACTGGTACACAATTTGG - Intergenic
1119957551 14:78815737-78815759 AAGGAAAGAGCTAAACAATTTGG - Intronic
1121121412 14:91378006-91378028 GAGGAGAGTGGTACAGAATTGGG + Intronic
1121944200 14:98103515-98103537 GAGCAAAGTGCTACAGAAGTTGG + Intergenic
1124867552 15:33507995-33508017 GAGTCCTGTGCTACACAACTAGG + Intronic
1130000974 15:80046251-80046273 GAAGAAAGGGCTATACAATTAGG + Intergenic
1130672046 15:85921235-85921257 GAGGCAAGTGCCTCACATTCAGG + Intergenic
1133823980 16:9260843-9260865 GTGCCAAGTGCTACAGAAATAGG - Intergenic
1150836564 17:68569258-68569280 GAGGTAACATCTACACAATTCGG - Intronic
1152698520 17:81807819-81807841 GTGGCAACAGCTACACAAATCGG - Intronic
1153618033 18:6952071-6952093 GAGGCCAGAGCTACACAGGTAGG + Intronic
1153904508 18:9649484-9649506 TAGGCAATTGTAACACAATTGGG - Intergenic
1156788021 18:40939290-40939312 TACCCAAGTGCTCCACAATTAGG + Intergenic
1160123549 18:76151035-76151057 GAGGGAAGGCCTACACACTTCGG + Intergenic
1165983516 19:39747046-39747068 GAGGCAATAGCTACAGAATCAGG + Intergenic
1166433885 19:42750876-42750898 GAGGCCAATGTTTCACAATTGGG + Intronic
1166437016 19:42776212-42776234 GAGGCCAATGTTTCACAATTGGG + Intronic
1166453655 19:42922325-42922347 GAGGCCAATGTTTCACAATTGGG + Intronic
1166483199 19:43190905-43190927 AAGGCCAGTGTTTCACAATTGGG + Intronic
1166488965 19:43241035-43241057 GAGGAATGTGCTAAACAAATGGG + Intronic
925962567 2:9031895-9031917 ATGGCAGATGCTACACAATTTGG - Intergenic
929630094 2:43451186-43451208 GAGGCAAGTGATCAACAGTTTGG + Intronic
931121324 2:59223526-59223548 CAGGCAATTGCTTCACAATGGGG - Intergenic
933492962 2:83011891-83011913 GATGGAAGTTCTTCACAATTTGG + Intergenic
935548676 2:104428457-104428479 GTGGAAAGTCCTTCACAATTTGG - Intergenic
936528561 2:113259020-113259042 GAGGCAAGTGAGACACACATGGG + Intronic
940974889 2:159931511-159931533 GAGGAAAGTTATACACATTTGGG + Intergenic
942576122 2:177364892-177364914 GATTCAAGTCCTACCCAATTTGG - Intronic
944658503 2:201900530-201900552 GAGCCAGGTGGTACACAATCAGG + Intergenic
945239241 2:207661077-207661099 GAGGAAGGTGCTTCACAGTTTGG + Intergenic
945246961 2:207727599-207727621 GTGGCAAATGCTACAACATTTGG - Intronic
947338714 2:229114506-229114528 CAGGCAGGTCCTTCACAATTGGG + Intronic
1171175000 20:23045107-23045129 GAAGGAAGAGCTACACAAATGGG - Intergenic
1172920112 20:38473689-38473711 GACCCAAGTGCTTAACAATTAGG + Intronic
1173061193 20:39662860-39662882 GAGGCAAGACCCACAAAATTTGG - Intergenic
1176664908 21:9677405-9677427 GAGACAACTGCTACACAACATGG + Intergenic
1178766057 21:35451942-35451964 GTGGGAAGTGCCACACACTTTGG + Intronic
1180907879 22:19428235-19428257 TAGACAAGTGCTTCTCAATTGGG + Intronic
1182887433 22:33787246-33787268 GAGGCAAGTTTTACAGAATATGG + Intronic
1183312856 22:37120723-37120745 GGGCCAAGTGGTACAGAATTGGG + Intergenic
1183397785 22:37582662-37582684 GAGGGCAGTGCCACACACTTTGG - Intergenic
1183949308 22:41343783-41343805 GAGGCAGGTGGGACACATTTGGG + Intronic
954114366 3:48457293-48457315 GAAGCATGTTCTCCACAATTTGG + Exonic
956614519 3:71157723-71157745 GAGGCTAGTGATACAAAGTTGGG + Intronic
960248332 3:115424521-115424543 GAGCCAAGTGCTAAACATTTAGG - Intergenic
970178817 4:13366126-13366148 GAGCCAGGGGCTACACAAATTGG - Intronic
970342950 4:15126056-15126078 TACGCAAGTGCTATACTATTGGG - Intergenic
973079467 4:45971696-45971718 AAGGCATGTGCTACACTTTTAGG - Intergenic
973160837 4:47014501-47014523 GGGGGAAATGCTACACATTTTGG - Intronic
973932472 4:55806943-55806965 GAGCCAAGTGCTAGACAATTAGG - Intergenic
978274013 4:106926858-106926880 GAGGCAAGGGGTGCACAAATGGG - Intronic
985410379 4:189677849-189677871 GAGACAACTGCTACACAACATGG + Intergenic
989214854 5:38893110-38893132 GAGCCAGCTGCTACACAAGTAGG - Intronic
989717685 5:44483364-44483386 CCGGCAAGTGCTACACACTTTGG + Intergenic
990166332 5:52997718-52997740 AAGGCAACTGGTAAACAATTTGG - Intronic
990794806 5:59527652-59527674 GAAGAAAGTGATATACAATTTGG - Intronic
995133821 5:108659292-108659314 TAGGCAAGTTAAACACAATTAGG - Intergenic
1012936746 6:105376105-105376127 GAGGTAAGTGCTACACAGAGAGG - Exonic
1028611592 7:92718096-92718118 GAGGGAAGTGGAACACAATGGGG - Intronic
1028958876 7:96726286-96726308 GAGGCAAGCTCTACCTAATTGGG + Intergenic
1036217847 8:6895728-6895750 GAGGAAAATGCTACAGCATTGGG - Intergenic
1048032149 8:130642822-130642844 GAGACAAGGACTACACAATGTGG - Intergenic
1050599407 9:7235293-7235315 GACCCAAGTGCCAGACAATTGGG - Intergenic
1052468843 9:28866604-28866626 GACTTAAGTGCTACACAATATGG + Intergenic
1058102887 9:100936991-100937013 GAGCCAGGTGCTTCACAAGTTGG + Intergenic
1061707723 9:132465887-132465909 GAGGCAAGTGGTTCAAAATAAGG + Intronic
1203661193 Un_KI270753v1:44344-44366 GAGACAACTGCTACACAACATGG - Intergenic
1203672379 Un_KI270755v1:27576-27598 GAGACAACTGCTACACAACATGG - Intergenic
1185685073 X:1922077-1922099 TAGGTAAGTGCTAAACACTTAGG - Intergenic
1186187605 X:7037149-7037171 GAGGAATGTGCTAAACAAATGGG + Intergenic
1187381424 X:18805332-18805354 GAGGGAAATGCCACACAACTTGG - Intronic