ID: 1072825044

View in Genome Browser
Species Human (GRCh38)
Location 10:98598443-98598465
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 171}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072825044_1072825047 -8 Left 1072825044 10:98598443-98598465 CCTGGAGCCTGTATCCATGACAG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1072825047 10:98598458-98598480 CATGACAGCCAGTCTAAGACTGG No data
1072825044_1072825055 24 Left 1072825044 10:98598443-98598465 CCTGGAGCCTGTATCCATGACAG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1072825055 10:98598490-98598512 GGTTGACCTGGTGCTGGTGTGGG No data
1072825044_1072825054 23 Left 1072825044 10:98598443-98598465 CCTGGAGCCTGTATCCATGACAG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1072825054 10:98598489-98598511 AGGTTGACCTGGTGCTGGTGTGG No data
1072825044_1072825053 18 Left 1072825044 10:98598443-98598465 CCTGGAGCCTGTATCCATGACAG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1072825053 10:98598484-98598506 CATAGAGGTTGACCTGGTGCTGG No data
1072825044_1072825050 3 Left 1072825044 10:98598443-98598465 CCTGGAGCCTGTATCCATGACAG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1072825050 10:98598469-98598491 GTCTAAGACTGGGTCCATAGAGG No data
1072825044_1072825048 -7 Left 1072825044 10:98598443-98598465 CCTGGAGCCTGTATCCATGACAG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1072825048 10:98598459-98598481 ATGACAGCCAGTCTAAGACTGGG No data
1072825044_1072825051 12 Left 1072825044 10:98598443-98598465 CCTGGAGCCTGTATCCATGACAG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1072825051 10:98598478-98598500 TGGGTCCATAGAGGTTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072825044 Original CRISPR CTGTCATGGATACAGGCTCC AGG (reversed) Intronic