ID: 1072825045

View in Genome Browser
Species Human (GRCh38)
Location 10:98598450-98598472
Sequence AGACTGGCTGTCATGGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072825045_1072825050 -4 Left 1072825045 10:98598450-98598472 CCTGTATCCATGACAGCCAGTCT No data
Right 1072825050 10:98598469-98598491 GTCTAAGACTGGGTCCATAGAGG No data
1072825045_1072825054 16 Left 1072825045 10:98598450-98598472 CCTGTATCCATGACAGCCAGTCT No data
Right 1072825054 10:98598489-98598511 AGGTTGACCTGGTGCTGGTGTGG No data
1072825045_1072825051 5 Left 1072825045 10:98598450-98598472 CCTGTATCCATGACAGCCAGTCT No data
Right 1072825051 10:98598478-98598500 TGGGTCCATAGAGGTTGACCTGG No data
1072825045_1072825053 11 Left 1072825045 10:98598450-98598472 CCTGTATCCATGACAGCCAGTCT No data
Right 1072825053 10:98598484-98598506 CATAGAGGTTGACCTGGTGCTGG No data
1072825045_1072825055 17 Left 1072825045 10:98598450-98598472 CCTGTATCCATGACAGCCAGTCT No data
Right 1072825055 10:98598490-98598512 GGTTGACCTGGTGCTGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072825045 Original CRISPR AGACTGGCTGTCATGGATAC AGG (reversed) Intronic