ID: 1072825046

View in Genome Browser
Species Human (GRCh38)
Location 10:98598457-98598479
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072825046_1072825051 -2 Left 1072825046 10:98598457-98598479 CCATGACAGCCAGTCTAAGACTG No data
Right 1072825051 10:98598478-98598500 TGGGTCCATAGAGGTTGACCTGG No data
1072825046_1072825053 4 Left 1072825046 10:98598457-98598479 CCATGACAGCCAGTCTAAGACTG No data
Right 1072825053 10:98598484-98598506 CATAGAGGTTGACCTGGTGCTGG No data
1072825046_1072825054 9 Left 1072825046 10:98598457-98598479 CCATGACAGCCAGTCTAAGACTG No data
Right 1072825054 10:98598489-98598511 AGGTTGACCTGGTGCTGGTGTGG No data
1072825046_1072825055 10 Left 1072825046 10:98598457-98598479 CCATGACAGCCAGTCTAAGACTG No data
Right 1072825055 10:98598490-98598512 GGTTGACCTGGTGCTGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072825046 Original CRISPR CAGTCTTAGACTGGCTGTCA TGG (reversed) Intronic