ID: 1072825049

View in Genome Browser
Species Human (GRCh38)
Location 10:98598466-98598488
Sequence CTATGGACCCAGTCTTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072825049_1072825057 22 Left 1072825049 10:98598466-98598488 CCAGTCTAAGACTGGGTCCATAG No data
Right 1072825057 10:98598511-98598533 GGCCTTGAGCCTGAATCTTCTGG No data
1072825049_1072825054 0 Left 1072825049 10:98598466-98598488 CCAGTCTAAGACTGGGTCCATAG No data
Right 1072825054 10:98598489-98598511 AGGTTGACCTGGTGCTGGTGTGG No data
1072825049_1072825055 1 Left 1072825049 10:98598466-98598488 CCAGTCTAAGACTGGGTCCATAG No data
Right 1072825055 10:98598490-98598512 GGTTGACCTGGTGCTGGTGTGGG No data
1072825049_1072825053 -5 Left 1072825049 10:98598466-98598488 CCAGTCTAAGACTGGGTCCATAG No data
Right 1072825053 10:98598484-98598506 CATAGAGGTTGACCTGGTGCTGG No data
1072825049_1072825058 23 Left 1072825049 10:98598466-98598488 CCAGTCTAAGACTGGGTCCATAG No data
Right 1072825058 10:98598512-98598534 GCCTTGAGCCTGAATCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072825049 Original CRISPR CTATGGACCCAGTCTTAGAC TGG (reversed) Intronic