ID: 1072825050

View in Genome Browser
Species Human (GRCh38)
Location 10:98598469-98598491
Sequence GTCTAAGACTGGGTCCATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072825042_1072825050 23 Left 1072825042 10:98598423-98598445 CCTGTATCTGTGGGGATGAACCT No data
Right 1072825050 10:98598469-98598491 GTCTAAGACTGGGTCCATAGAGG No data
1072825041_1072825050 30 Left 1072825041 10:98598416-98598438 CCTGGAGCCTGTATCTGTGGGGA No data
Right 1072825050 10:98598469-98598491 GTCTAAGACTGGGTCCATAGAGG No data
1072825044_1072825050 3 Left 1072825044 10:98598443-98598465 CCTGGAGCCTGTATCCATGACAG No data
Right 1072825050 10:98598469-98598491 GTCTAAGACTGGGTCCATAGAGG No data
1072825045_1072825050 -4 Left 1072825045 10:98598450-98598472 CCTGTATCCATGACAGCCAGTCT No data
Right 1072825050 10:98598469-98598491 GTCTAAGACTGGGTCCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072825050 Original CRISPR GTCTAAGACTGGGTCCATAG AGG Intronic