ID: 1072825051

View in Genome Browser
Species Human (GRCh38)
Location 10:98598478-98598500
Sequence TGGGTCCATAGAGGTTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072825046_1072825051 -2 Left 1072825046 10:98598457-98598479 CCATGACAGCCAGTCTAAGACTG No data
Right 1072825051 10:98598478-98598500 TGGGTCCATAGAGGTTGACCTGG No data
1072825045_1072825051 5 Left 1072825045 10:98598450-98598472 CCTGTATCCATGACAGCCAGTCT No data
Right 1072825051 10:98598478-98598500 TGGGTCCATAGAGGTTGACCTGG No data
1072825044_1072825051 12 Left 1072825044 10:98598443-98598465 CCTGGAGCCTGTATCCATGACAG No data
Right 1072825051 10:98598478-98598500 TGGGTCCATAGAGGTTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072825051 Original CRISPR TGGGTCCATAGAGGTTGACC TGG Intronic