ID: 1072825051 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:98598478-98598500 |
| Sequence | TGGGTCCATAGAGGTTGACC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072825046_1072825051 | -2 | Left | 1072825046 | 10:98598457-98598479 | CCATGACAGCCAGTCTAAGACTG | No data | ||
| Right | 1072825051 | 10:98598478-98598500 | TGGGTCCATAGAGGTTGACCTGG | No data | ||||
| 1072825045_1072825051 | 5 | Left | 1072825045 | 10:98598450-98598472 | CCTGTATCCATGACAGCCAGTCT | No data | ||
| Right | 1072825051 | 10:98598478-98598500 | TGGGTCCATAGAGGTTGACCTGG | No data | ||||
| 1072825044_1072825051 | 12 | Left | 1072825044 | 10:98598443-98598465 | CCTGGAGCCTGTATCCATGACAG | No data | ||
| Right | 1072825051 | 10:98598478-98598500 | TGGGTCCATAGAGGTTGACCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072825051 | Original CRISPR | TGGGTCCATAGAGGTTGACC TGG | Intronic | ||