ID: 1072825053

View in Genome Browser
Species Human (GRCh38)
Location 10:98598484-98598506
Sequence CATAGAGGTTGACCTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072825044_1072825053 18 Left 1072825044 10:98598443-98598465 CCTGGAGCCTGTATCCATGACAG No data
Right 1072825053 10:98598484-98598506 CATAGAGGTTGACCTGGTGCTGG No data
1072825049_1072825053 -5 Left 1072825049 10:98598466-98598488 CCAGTCTAAGACTGGGTCCATAG No data
Right 1072825053 10:98598484-98598506 CATAGAGGTTGACCTGGTGCTGG No data
1072825045_1072825053 11 Left 1072825045 10:98598450-98598472 CCTGTATCCATGACAGCCAGTCT No data
Right 1072825053 10:98598484-98598506 CATAGAGGTTGACCTGGTGCTGG No data
1072825046_1072825053 4 Left 1072825046 10:98598457-98598479 CCATGACAGCCAGTCTAAGACTG No data
Right 1072825053 10:98598484-98598506 CATAGAGGTTGACCTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072825053 Original CRISPR CATAGAGGTTGACCTGGTGC TGG Intronic