ID: 1072825222

View in Genome Browser
Species Human (GRCh38)
Location 10:98599225-98599247
Sequence TTCAGGACTACCCCAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072825222_1072825226 -2 Left 1072825222 10:98599225-98599247 CCTGGTTCTGGGGTAGTCCTGAA 0: 1
1: 0
2: 3
3: 28
4: 178
Right 1072825226 10:98599246-98599268 AAGCCTGAGGCCACAGGAGCTGG No data
1072825222_1072825231 13 Left 1072825222 10:98599225-98599247 CCTGGTTCTGGGGTAGTCCTGAA 0: 1
1: 0
2: 3
3: 28
4: 178
Right 1072825231 10:98599261-98599283 GGAGCTGGCTGGTGCTAGACGGG No data
1072825222_1072825224 -8 Left 1072825222 10:98599225-98599247 CCTGGTTCTGGGGTAGTCCTGAA 0: 1
1: 0
2: 3
3: 28
4: 178
Right 1072825224 10:98599240-98599262 GTCCTGAAGCCTGAGGCCACAGG No data
1072825222_1072825230 12 Left 1072825222 10:98599225-98599247 CCTGGTTCTGGGGTAGTCCTGAA 0: 1
1: 0
2: 3
3: 28
4: 178
Right 1072825230 10:98599260-98599282 AGGAGCTGGCTGGTGCTAGACGG No data
1072825222_1072825228 2 Left 1072825222 10:98599225-98599247 CCTGGTTCTGGGGTAGTCCTGAA 0: 1
1: 0
2: 3
3: 28
4: 178
Right 1072825228 10:98599250-98599272 CTGAGGCCACAGGAGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072825222 Original CRISPR TTCAGGACTACCCCAGAACC AGG (reversed) Intronic
900806999 1:4774102-4774124 TGCAGGATTAGCCCAGAGCCTGG - Intronic
902563147 1:17290805-17290827 TTGAGGACTACAGCAGTACCTGG + Intergenic
903782054 1:25826939-25826961 TTCAGGACAACCCCAGGGCCCGG - Intronic
907023096 1:51087527-51087549 GTCAGGACCAGCTCAGAACCGGG - Intergenic
908351004 1:63286366-63286388 TTCAGGCCCACCCCAGCACCAGG + Intergenic
914958747 1:152188017-152188039 TTAAGGACCACTCCAGAAACAGG - Intergenic
915071531 1:153272739-153272761 TTTAGGCCCACCCCAGCACCAGG - Intergenic
916365051 1:164017290-164017312 TTCAGGCCTACCCCAGCACCAGG + Intergenic
917509236 1:175656466-175656488 TTCAGGACTAAACCATAATCAGG - Intronic
921429993 1:215054399-215054421 TTCAGGACCATCCCTGCACCAGG + Intronic
1064888053 10:20134787-20134809 TCCAGGCCCACCCCAAAACCAGG - Intronic
1065462414 10:25982635-25982657 CTCAGTACTAACCCAGAGCCTGG + Intronic
1066633663 10:37480572-37480594 TTCACCACTACCACAGATCCTGG - Intergenic
1067779398 10:49188528-49188550 TTCTGGACTCCACCAGAAGCTGG + Intronic
1071067851 10:81656943-81656965 TTCAGGCCTACCTTAGAACCAGG - Intergenic
1071448996 10:85776803-85776825 TTGAGGACTATGCCAGAACATGG - Intronic
1072038362 10:91584868-91584890 GTCAGCCCTGCCCCAGAACCTGG + Intergenic
1072715851 10:97752039-97752061 CTCAGGACTACCAGAGAAACTGG - Intronic
1072825083 10:98598638-98598660 TTCAGGCCTGTCCCAGCACCAGG - Intronic
1072825222 10:98599225-98599247 TTCAGGACTACCCCAGAACCAGG - Intronic
1073025890 10:100487116-100487138 GTCAGCTCTACCCCAGACCCTGG + Exonic
1079120720 11:17682745-17682767 GTCAGGACAACCCCAGCAACAGG - Intergenic
1081368940 11:42274583-42274605 TCCAGGGCTGCTCCAGAACCAGG + Intergenic
1081691068 11:45079057-45079079 TTTAGGATTAGCCCAGAGCCAGG + Intergenic
1082955314 11:58864024-58864046 TTCAGGCCAACCCCAGTTCCAGG - Intronic
1082976404 11:59076911-59076933 TTCAGGCCAACCCCAGTTCCAGG - Intergenic
1083697611 11:64453285-64453307 ATCAGGATTTCCCCAGTACCGGG + Intergenic
1085771519 11:79330231-79330253 ATCAAGTCTACCCCTGAACCTGG - Intronic
1086305870 11:85481736-85481758 TTCAGGCCTGCCCCAGTACCAGG + Intronic
1087381357 11:97408894-97408916 TCCAGGCCTACTCCAGTACCAGG + Intergenic
1088420123 11:109636119-109636141 TCCAGGCCTACCCCAAAGCCAGG - Intergenic
1091635954 12:2196880-2196902 TTCAGAACTGCCCCAGACCAAGG + Intronic
1094100869 12:26761020-26761042 TTAAGGGCCACCCCAGCACCTGG + Intronic
1095951809 12:47785676-47785698 CTCAGGACTACCCAAGGAGCAGG - Intronic
1096026532 12:48368875-48368897 TTCAGGCTTACCCTAGCACCAGG + Intergenic
1096122202 12:49095311-49095333 TTTGGAACTTCCCCAGAACCAGG + Intergenic
1098414312 12:70215475-70215497 TCTAGGACCACCCCAGCACCAGG - Intergenic
1101042224 12:100768048-100768070 TTCAGAACTGCCCCAGTGCCAGG - Intronic
1101150091 12:101876538-101876560 GTCTGGGCTACTCCAGAACCTGG + Intergenic
1101167406 12:102052618-102052640 TTCAGGCCCACCCCAGCACCAGG + Intronic
1106662492 13:31814530-31814552 TCCAGGACTGCCCCAGAACCAGG + Intergenic
1110147846 13:72214517-72214539 TTAAGGTCTACCCCAAATCCTGG + Intergenic
1110808915 13:79790877-79790899 TTAAGGCCTACCCCAGTGCCAGG - Intergenic
1112793516 13:103029680-103029702 TTCAGGTCCACCCAAGCACCAGG - Intergenic
1113109410 13:106806119-106806141 TTCAGCACTAATCCAGATCCTGG + Intergenic
1114398904 14:22391594-22391616 TCCTGGACTGCCCCTGAACCTGG + Intergenic
1115178338 14:30591712-30591734 TTAAGGACTACCCTAAATCCAGG + Intronic
1118337916 14:64870157-64870179 ATCAGCGCTACCCCAGGACCTGG + Intronic
1120237058 14:81903946-81903968 TTCAGGCCTGCCCCAACACCAGG - Intergenic
1121334721 14:93070282-93070304 TTCAGGACTATTCCAGAAAGAGG + Intronic
1121404136 14:93708677-93708699 CTCAGGACTAGCCAAGAGCCAGG - Intergenic
1126056222 15:44732410-44732432 TTAAGGACGACCCCAGTATCTGG - Intronic
1126709723 15:51443016-51443038 TTCAGGCCCACCCCAGCACCAGG - Intergenic
1129052906 15:72797276-72797298 TCCCGGACTACCCCAGGACTTGG + Intergenic
1130385598 15:83408525-83408547 TTCAGCACTTCCTAAGAACCAGG + Intergenic
1131321755 15:91400135-91400157 TCCAGGCCTTCCCCAGAACCAGG - Intergenic
1134797750 16:17057096-17057118 TCCAGGCCCACCCCAGCACCAGG - Intergenic
1136394216 16:29984068-29984090 TTCAGGACCACCCAAGCACAGGG - Intronic
1137316732 16:47332770-47332792 TTTAGGAATGGCCCAGAACCAGG + Intronic
1138216398 16:55208578-55208600 CTCATGACTAGCCCAGCACCTGG + Intergenic
1139176973 16:64700744-64700766 TTCAGGGCAACCCCAGCACCAGG + Intergenic
1139297680 16:65917478-65917500 TTCAGCACTACCCCAGAGAGAGG + Intergenic
1144951039 17:18993586-18993608 CTCAAGCCTGCCCCAGAACCTGG + Intronic
1150178060 17:63083151-63083173 TTCAGGACCACCCCTGAATGGGG + Intronic
1150540088 17:66088402-66088424 TTCAGGCCTACCCAGGAACCAGG + Intronic
1151667979 17:75556500-75556522 TTCAGGAATCCCCCAGTCCCGGG + Intronic
1151703339 17:75754527-75754549 GTCAGGCCTGCCCCAGACCCGGG - Intronic
1154947837 18:21179730-21179752 TTCAGGACTTCCCCTCAGCCTGG - Intergenic
1156245015 18:35289813-35289835 TTCAGGATCACCTGAGAACCTGG + Intronic
1157598578 18:48878728-48878750 TGCAGGAGCACCCCCGAACCTGG + Intergenic
1160574319 18:79842122-79842144 TCCAGGCCTACCCCAGCACAAGG + Intergenic
1162613358 19:11774170-11774192 ATCAGCACTACCCCTGAAGCCGG - Intronic
1162936997 19:13986352-13986374 TTGAGGGCTACCCCAGAGGCAGG - Intronic
1163523721 19:17807776-17807798 CTCAGGCCGACCCCAGACCCTGG + Exonic
1165281450 19:34801730-34801752 CTCAGGACTTCTCCAGCACCAGG - Intergenic
1166181812 19:41114154-41114176 CCCATGACTACCCCAAAACCAGG + Intergenic
925066007 2:929308-929330 TTCAGGCATATCCCAGAGCCAGG - Intergenic
927945767 2:27134344-27134366 TTCAGGTCGACCCCAGCACTGGG - Exonic
928466324 2:31526223-31526245 TTGAGGACTACCCCAAATCTCGG - Exonic
928710313 2:33997579-33997601 TTCAGGACTTCCCCAGTGCCAGG - Intergenic
929495527 2:42439029-42439051 TTCAGGACATTCTCAGAACCAGG - Intergenic
930461365 2:51682127-51682149 TTCAGGACAAGCACAGAAACAGG + Intergenic
931759097 2:65400736-65400758 TTCAGGACTGAACCAGAAACAGG - Intronic
936418303 2:112339902-112339924 TTAAGGACTAACCCAGTACTTGG + Exonic
936428223 2:112436884-112436906 TCCAGGACTACCCCACAGCCCGG - Intergenic
937273286 2:120669008-120669030 TGGAGGACTACCTCTGAACCAGG - Intergenic
937561539 2:123230837-123230859 CTCAGCACCAGCCCAGAACCTGG - Intergenic
938732085 2:134154454-134154476 ATCAGGACTTCCCCAAAACGGGG - Intronic
940693262 2:156946659-156946681 TTCAGTCTTACCCAAGAACCTGG - Intergenic
940718549 2:157256762-157256784 TTCAGGACCACACCAGGACTTGG - Intergenic
940852723 2:158703729-158703751 TTTAGGACAACCCTAAAACCAGG + Intergenic
941868574 2:170360086-170360108 CTCAGGACTATACCAGAACTGGG - Intronic
943878322 2:193102554-193102576 TTCCAGACCACCCCAGAATCAGG - Intergenic
944057126 2:195534402-195534424 TTCAGTACTGCCACAGATCCTGG - Intergenic
944373408 2:199011971-199011993 TTCAGGCGTGCCCCAGCACCAGG - Intergenic
944373443 2:199012102-199012124 TTCAGGCCTAACCCTGCACCAGG - Intergenic
1170208248 20:13822710-13822732 TTCAGCCTGACCCCAGAACCTGG + Intergenic
1173769986 20:45647929-45647951 TTCAAGTCTACCTCAGCACCAGG - Intergenic
1177401119 21:20606249-20606271 TTCTGGACTCACCCAGGACCTGG + Intergenic
1178549357 21:33522782-33522804 TTCCCCACTACCCCAGACCCTGG + Intronic
1179390901 21:40990360-40990382 TGAAGGTCTACCCCAGAGCCAGG - Intergenic
1179390952 21:40990615-40990637 TTCAGGACCTCTCCAGCACCAGG - Intergenic
1180622912 22:17173667-17173689 CTCAGGACTGCCCCAAAATCTGG - Intergenic
1182051170 22:27313947-27313969 TTATGAATTACCCCAGAACCAGG - Intergenic
951022334 3:17793946-17793968 TTCAGGCCTACCCCAGCACCAGG - Intronic
952638193 3:35557403-35557425 TCCAGGACCACCTCAGTACCAGG + Intergenic
952984813 3:38769858-38769880 CCCAGTACTACCCCAGAGCCTGG - Intronic
953435974 3:42877446-42877468 TTCAGGACCACCACAGTACTTGG + Intronic
953854780 3:46492916-46492938 TTAAGGCCTACCCCAAATCCAGG + Intergenic
958776307 3:98487307-98487329 CTCAGACCTACCCTAGAACCAGG + Intergenic
960740787 3:120831196-120831218 TTCAGGACTAGCTAAGTACCTGG + Intergenic
960967604 3:123116090-123116112 CTCAGGACTATTCCAGACCCTGG - Intronic
964632194 3:158823617-158823639 TTCAGCGCTACCCCAGAGGCTGG - Intronic
965444948 3:168763646-168763668 TTCAGGCCTACCCTAGAGCCAGG - Intergenic
966242140 3:177766409-177766431 TTCAGGATTCCCCCAGACCTAGG + Intergenic
967134082 3:186498007-186498029 TTCAGGCCTGCCCCAGCACCAGG + Intergenic
967553107 3:190823012-190823034 TTCAGTCTTGCCCCAGAACCAGG - Intergenic
969901416 4:10354048-10354070 TTCAGTACCAGCCCAGAGCCTGG - Intergenic
970380350 4:15501159-15501181 TTCAGGCATACTCCAAAACCTGG - Intronic
970569508 4:17366021-17366043 TTCAGGTCTACACCACTACCTGG - Intergenic
972748759 4:41968095-41968117 TACAGCAGTACCCCAGTACCTGG - Intergenic
973140823 4:46765931-46765953 TTCAGGCCTACTCCAGCACTAGG + Intronic
975172933 4:71253598-71253620 TTCAGGACTCCCTCAGTAACTGG + Intronic
975428035 4:74253718-74253740 TTCATGCCCACCGCAGAACCAGG + Intronic
977670677 4:99691849-99691871 TCCAGGCCTGCCCCAGCACCAGG - Intergenic
978339477 4:107707166-107707188 TTCAGGTCTGCCCCAGTACAAGG - Intronic
979487184 4:121283248-121283270 TTCTGGTCTACCCCAAAGCCAGG + Intergenic
979487222 4:121283382-121283404 TTCAGGACCACCTCAGCCCCAGG + Intergenic
979712622 4:123797935-123797957 TCCAGCACTGGCCCAGAACCAGG - Intergenic
979940715 4:126758836-126758858 TCCAGGTCTACCCCAGTGCCAGG - Intergenic
986070536 5:4278482-4278504 TTCGGGACGCCCCCAGAATCGGG - Intergenic
986873259 5:12075766-12075788 TTCAGGTTGACCCCAGAATCGGG + Intergenic
988419891 5:30992473-30992495 TTCACAGCTACCCCAGAAGCAGG - Intergenic
991956922 5:72004361-72004383 TTCAGGGCTACCCCAAAAGGAGG - Intergenic
992191072 5:74292609-74292631 TTCCAGACTAGCCCAGGACCTGG - Intergenic
993173409 5:84451340-84451362 ATCATGAATATCCCAGAACCTGG + Intergenic
997895060 5:137708997-137709019 CTCAGCACTTCCCCTGAACCAGG - Intronic
1001713529 5:173796222-173796244 TTCAGGAATATTCCAGAGCCAGG - Intergenic
1003126442 6:3359959-3359981 TTCAGGATTCCCTCAGAACAAGG - Intronic
1003984251 6:11419551-11419573 TCCAGGCCTTCCCTAGAACCAGG + Intergenic
1004814457 6:19297905-19297927 CTCTGGAATATCCCAGAACCAGG - Intergenic
1005165716 6:22917953-22917975 TTGAGTACTACCCAAAAACCTGG - Intergenic
1008726246 6:54424497-54424519 TTCAGGACTACAGCATAACAGGG + Intergenic
1010500570 6:76594332-76594354 CTCAGTACTAGCCCAGAGCCTGG + Intergenic
1011163011 6:84413408-84413430 TTCAGGACTCCCCAAGATTCAGG - Intergenic
1017329641 6:153181231-153181253 TTCAAGACTAGCCCATAACAGGG + Intergenic
1018544448 6:164919418-164919440 TTCAGGCCCTCCCCAGCACCAGG - Intergenic
1018679526 6:166252749-166252771 ACCAGGACGACCCCAGAACTGGG - Intergenic
1020358521 7:7303181-7303203 TTCAGTACCAGCCCAGAGCCTGG - Intergenic
1020429268 7:8102993-8103015 TTTCGGCCTACCCCAGACCCTGG - Intergenic
1021340174 7:19455377-19455399 TCCAGTACCAGCCCAGAACCAGG - Intergenic
1023001256 7:35810296-35810318 TTTAGTACTACCCCAGAAACTGG - Intronic
1024907954 7:54410132-54410154 TCCAGGCCCACCCCAGACCCAGG + Intergenic
1024918118 7:54525958-54525980 TCAAGGACTACCCCAGCTCCAGG - Intergenic
1026391322 7:69905477-69905499 TTGAGGACTACCCCAGTCTCAGG - Intronic
1026911322 7:74093389-74093411 TTCAGTTCTGCCCCAGAGCCTGG - Intronic
1030004302 7:105100518-105100540 TTCAGCTCTAAACCAGAACCAGG - Intronic
1032486318 7:132290119-132290141 TGCAGGAGTCCCCCAGCACCTGG + Intronic
1032664720 7:134024630-134024652 TTAAGGAATTCCCCACAACCTGG + Intronic
1032785729 7:135197975-135197997 TTCAGGACAACCCCATACCTGGG + Exonic
1034285925 7:149882918-149882940 TTCTGGCCTCCCCCAGAGCCTGG + Intergenic
1035293486 7:157854661-157854683 GTCAGGACTGCCCCAGCCCCTGG + Intronic
1035358023 7:158290498-158290520 TTCAGGCCTGCCCCAATACCAGG - Intronic
1037119580 8:15266969-15266991 CTCAGGTCTGCCCCAGAACCAGG + Intergenic
1037960313 8:23092801-23092823 CATAGGACTCCCCCAGAACCAGG - Intronic
1041622716 8:59990756-59990778 CTCAGGCCTTCCCCAGCACCAGG - Intergenic
1044129684 8:88506032-88506054 TCCAGGACCACCCCAGCACCAGG + Intergenic
1044320594 8:90796328-90796350 CTCAGGACTAATCCAGAACATGG - Intronic
1045790402 8:105977762-105977784 TCCAGGCCTGCCCCAGCACCAGG + Intergenic
1046271714 8:111904856-111904878 TGCAGGACCACCCCAGAGCCAGG - Intergenic
1046282381 8:112050664-112050686 TTCCTGACTTCCCCAGAATCTGG - Intergenic
1047044482 8:121036772-121036794 GTCAGAATTACCTCAGAACCTGG + Intergenic
1051546307 9:18279888-18279910 TCCAGGCCCACCCCAGCACCAGG - Intergenic
1052832589 9:33228377-33228399 TTCAGGAATACGACAGAACCGGG - Intronic
1053523370 9:38804684-38804706 TTCAGACCTACCCAAGAACCAGG - Intergenic
1053598623 9:39588165-39588187 TCCAGGCCCACCCCAGAACCAGG - Intergenic
1054195599 9:62029103-62029125 TTCAGACCTACCCAAGAACCAGG - Intergenic
1054642808 9:67559586-67559608 TTCAGACCTACCCAAGAACCAGG + Intergenic
1058620370 9:106876910-106876932 TTGAGGACTGCCCCATAGCCTGG + Intronic
1059921111 9:119160889-119160911 TTCAGGAAAAACCCAGAACCTGG + Intronic
1059923671 9:119185701-119185723 GTCAGGATTAGCTCAGAACCAGG + Intronic
1060736958 9:126072091-126072113 TCCAGGGCTGGCCCAGAACCTGG + Intergenic
1061275631 9:129568331-129568353 CCCAGGAGGACCCCAGAACCCGG - Intergenic
1061782160 9:133002772-133002794 TGCAGGTCCAGCCCAGAACCTGG - Intergenic
1062036316 9:134384183-134384205 TCCAGGACTCCCCCCCAACCGGG - Intronic
1185826074 X:3251129-3251151 TTGAGGACTAGCCTAGGACCTGG - Intergenic
1187574077 X:20535404-20535426 TTCACCACTACCCCAATACCTGG - Intergenic
1189032389 X:37463860-37463882 TTCAGGAATATCCCAGAAAAGGG + Intronic
1189192145 X:39119504-39119526 TCCAGTACTAGCACAGAACCTGG + Intergenic
1189855717 X:45223400-45223422 TTCAGGCCAACCCCAGAACTAGG - Intergenic
1190189661 X:48266731-48266753 TTCTGCCCTACCCCAGGACCTGG - Intronic
1190717359 X:53115355-53115377 TTCAGGCCCACCCCAGCACCAGG - Intergenic
1190968219 X:55323220-55323242 TTCAGGATTGCCCCAGCACCAGG - Intergenic
1191910448 X:66143972-66143994 TTCAGGTCTACCTCAGCAACAGG - Intergenic
1192788204 X:74354728-74354750 TTCAGGCCTGCCACAGCACCAGG + Intergenic
1192822343 X:74658233-74658255 TTCTGGACCAACCCAGAGCCTGG - Intergenic
1194623683 X:96202729-96202751 TTCTGGACCCACCCAGAACCTGG + Intergenic
1195135786 X:101906475-101906497 TCCAGTCCCACCCCAGAACCAGG + Intronic
1195135949 X:101907178-101907200 TCAAGGCCTACCCCAGCACCAGG + Intronic
1195562743 X:106302399-106302421 TTCAGGACTACCTTAGAATGTGG + Intergenic
1195980786 X:110576409-110576431 TTAAGGAATACCCCAAAAGCAGG - Intergenic
1196082515 X:111648900-111648922 TCCAGGCTTACCCCAGCACCAGG - Intergenic
1196588473 X:117458430-117458452 TCCAGGACTGCCACAGTACCAGG + Intergenic
1197001274 X:121441914-121441936 TTCTAGACTACCCCAGCTCCAGG - Intergenic
1197083068 X:122441423-122441445 TTCATGTCTACCCCAGCACCAGG - Intergenic
1197123185 X:122914826-122914848 TTCAGGCCTATGCCAGCACCAGG - Intergenic
1197240091 X:124114335-124114357 TTCAGGCCCACCCCAGCACTAGG - Intronic
1198135048 X:133740915-133740937 TTCAGGCCTCCCCCAGAATCAGG - Intronic
1198182559 X:134223887-134223909 GCCAGGACTGCCCCAGGACCAGG - Intergenic
1199218540 X:145290059-145290081 TCCCGGACTACCCCAGTACTGGG - Intergenic