ID: 1072825225

View in Genome Browser
Species Human (GRCh38)
Location 10:98599242-98599264
Sequence CTCCTGTGGCCTCAGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072825225_1072825230 -5 Left 1072825225 10:98599242-98599264 CCTGAAGCCTGAGGCCACAGGAG No data
Right 1072825230 10:98599260-98599282 AGGAGCTGGCTGGTGCTAGACGG No data
1072825225_1072825233 19 Left 1072825225 10:98599242-98599264 CCTGAAGCCTGAGGCCACAGGAG No data
Right 1072825233 10:98599284-98599306 TCTAGAGTCTGTATCCACGGTGG No data
1072825225_1072825231 -4 Left 1072825225 10:98599242-98599264 CCTGAAGCCTGAGGCCACAGGAG No data
Right 1072825231 10:98599261-98599283 GGAGCTGGCTGGTGCTAGACGGG No data
1072825225_1072825232 16 Left 1072825225 10:98599242-98599264 CCTGAAGCCTGAGGCCACAGGAG No data
Right 1072825232 10:98599281-98599303 GGGTCTAGAGTCTGTATCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072825225 Original CRISPR CTCCTGTGGCCTCAGGCTTC AGG (reversed) Intronic