ID: 1072825231

View in Genome Browser
Species Human (GRCh38)
Location 10:98599261-98599283
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072825225_1072825231 -4 Left 1072825225 10:98599242-98599264 CCTGAAGCCTGAGGCCACAGGAG No data
Right 1072825231 10:98599261-98599283 GGAGCTGGCTGGTGCTAGACGGG No data
1072825222_1072825231 13 Left 1072825222 10:98599225-98599247 CCTGGTTCTGGGGTAGTCCTGAA 0: 1
1: 0
2: 3
3: 28
4: 178
Right 1072825231 10:98599261-98599283 GGAGCTGGCTGGTGCTAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr