ID: 1072825232

View in Genome Browser
Species Human (GRCh38)
Location 10:98599281-98599303
Sequence GGGTCTAGAGTCTGTATCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072825227_1072825232 9 Left 1072825227 10:98599249-98599271 CCTGAGGCCACAGGAGCTGGCTG 0: 1
1: 0
2: 4
3: 58
4: 437
Right 1072825232 10:98599281-98599303 GGGTCTAGAGTCTGTATCCACGG No data
1072825225_1072825232 16 Left 1072825225 10:98599242-98599264 CCTGAAGCCTGAGGCCACAGGAG No data
Right 1072825232 10:98599281-98599303 GGGTCTAGAGTCTGTATCCACGG No data
1072825229_1072825232 2 Left 1072825229 10:98599256-98599278 CCACAGGAGCTGGCTGGTGCTAG 0: 1
1: 0
2: 1
3: 18
4: 213
Right 1072825232 10:98599281-98599303 GGGTCTAGAGTCTGTATCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072825232 Original CRISPR GGGTCTAGAGTCTGTATCCA CGG Intronic
No off target data available for this crispr