ID: 1072829708

View in Genome Browser
Species Human (GRCh38)
Location 10:98644844-98644866
Sequence ACAGCTTGTAAGGGTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072829708_1072829716 17 Left 1072829708 10:98644844-98644866 CCAGTTTTACCCTTACAAGCTGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1072829716 10:98644884-98644906 TAATCTTGGGCTATTTCCGTGGG No data
1072829708_1072829713 3 Left 1072829708 10:98644844-98644866 CCAGTTTTACCCTTACAAGCTGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1072829713 10:98644870-98644892 CAATCATTCTCAGGTAATCTTGG No data
1072829708_1072829717 28 Left 1072829708 10:98644844-98644866 CCAGTTTTACCCTTACAAGCTGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1072829717 10:98644895-98644917 TATTTCCGTGGGCTGTGAATTGG No data
1072829708_1072829714 4 Left 1072829708 10:98644844-98644866 CCAGTTTTACCCTTACAAGCTGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1072829714 10:98644871-98644893 AATCATTCTCAGGTAATCTTGGG No data
1072829708_1072829715 16 Left 1072829708 10:98644844-98644866 CCAGTTTTACCCTTACAAGCTGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1072829715 10:98644883-98644905 GTAATCTTGGGCTATTTCCGTGG No data
1072829708_1072829711 -6 Left 1072829708 10:98644844-98644866 CCAGTTTTACCCTTACAAGCTGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1072829711 10:98644861-98644883 AGCTGTATCCAATCATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072829708 Original CRISPR ACAGCTTGTAAGGGTAAAAC TGG (reversed) Intronic
901121792 1:6901159-6901181 ACAGATTGTAATGGAACAACTGG + Intronic
901897514 1:12327167-12327189 GCAGCTGGTAAGGGCAGAACAGG + Intronic
903377873 1:22877733-22877755 ACAGCTGGTAGTGGTAAAGCTGG - Intronic
903697730 1:25220725-25220747 ACAGCAAGTAAGGGTAAAAGAGG + Intergenic
906975596 1:50568869-50568891 ACAGCTTGTAATGGGAATAAGGG + Intronic
907837434 1:58123652-58123674 ACAGCTAGTAAGGGCACACCAGG - Intronic
908193048 1:61722731-61722753 ACAACTTCAAAGTGTAAAACAGG - Intronic
911181847 1:94868031-94868053 ACAGCTTGAAAAGGAAAGACTGG - Intronic
916449283 1:164904370-164904392 ACAGCTTGTAAGGTGACATCAGG + Intergenic
916998496 1:170328561-170328583 GCAGTATGTAAGGGTCAAACTGG + Intergenic
923003044 1:230023299-230023321 AGAGCTTGAAAAGGGAAAACTGG + Intergenic
923250605 1:232176778-232176800 ACAGATTGTCAGAGAAAAACAGG + Intergenic
923900743 1:238323476-238323498 ACAGCTGGCAAAGGTAAAAGGGG - Intergenic
1062781156 10:209276-209298 ATACCTTGTAACGGTAAATCAGG + Intronic
1062823791 10:554027-554049 ACAGCTTGTAACTGTAAGAGTGG + Intronic
1066585391 10:36928440-36928462 ACAGTTTCTTAGGGTAAAAATGG + Intergenic
1068392500 10:56416090-56416112 AGAGCTTTTAAGAGTAAAACTGG - Intergenic
1070619877 10:78001156-78001178 GCAGATTGGAAGGGTAAAACAGG + Intronic
1072250401 10:93577803-93577825 ACAGCTTGTAAGTGGCAATCAGG + Intronic
1072829708 10:98644844-98644866 ACAGCTTGTAAGGGTAAAACTGG - Intronic
1072894570 10:99355685-99355707 ACAGCCTGTAAGAGCAAAGCTGG - Intronic
1073461136 10:103666606-103666628 AGAGCTAGTAAGGGCAAAGCAGG - Intronic
1073838780 10:107474547-107474569 ACAGCTTGTAAGTGGTAAACTGG - Intergenic
1075862364 10:125687910-125687932 TCACCTTGTAAGGGTGAATCTGG + Intergenic
1079921522 11:26439091-26439113 ACAACTTGTATGGGAACAACTGG + Intronic
1081525616 11:43925609-43925631 ACTGCCTGCAAGGGTAGAACTGG + Intronic
1083744395 11:64727128-64727150 ACAGCTGGGAAGAGAAAAACAGG + Exonic
1085902748 11:80721433-80721455 ACAGTTTCTTAGGGTAAAAATGG - Intergenic
1086269381 11:85042291-85042313 ACAGCTTGAAATGAGAAAACAGG + Intronic
1086385167 11:86299716-86299738 ACAGAATGCAAGGGTAAGACAGG - Intergenic
1090860666 11:130649721-130649743 GGAGCTTCTAGGGGTAAAACTGG + Intergenic
1093763304 12:22934894-22934916 ACAGCTTGTGAGGTTAAGTCTGG - Intergenic
1095538866 12:43285032-43285054 ACAGCTTGTAAGGGTGGGAAAGG + Intergenic
1096223609 12:49849102-49849124 ACAGATTGTAAAAGAAAAACAGG + Intergenic
1098378671 12:69844632-69844654 ACAGCTTGTAAGTGACACACAGG - Intronic
1100727513 12:97424569-97424591 ACAACTTGTAAGGGGGGAACTGG - Intergenic
1107391407 13:39968508-39968530 ATAGCTTGTAAGAGAAAGACTGG + Intergenic
1108730331 13:53228787-53228809 AAAGGTGGTAAGGGTAGAACTGG + Intergenic
1109549400 13:63873575-63873597 AGAGGTAGTAAGGGTAAAATAGG - Intergenic
1110434446 13:75463777-75463799 ACAGGTTTTAGGGGTAAATCAGG - Intronic
1116007463 14:39310582-39310604 ACTGCTCCTAAGGGTAATACAGG - Intronic
1116053810 14:39838663-39838685 ACAGCTGGTAGGTGGAAAACTGG + Intergenic
1117237867 14:53797844-53797866 ACCAGTTGAAAGGGTAAAACAGG - Intergenic
1118752195 14:68815665-68815687 AAAGACTGTAAGGGAAAAACAGG + Intergenic
1119305112 14:73601450-73601472 ACAACTTGGGAGGCTAAAACAGG + Intergenic
1120040619 14:79748846-79748868 ACAGCATTTATGGGGAAAACAGG - Intronic
1120344792 14:83272499-83272521 ATAGACTATAAGGGTAAAACAGG + Intergenic
1124452738 15:29811353-29811375 ACAGATTGTAAGGGGAAGAGGGG + Intronic
1130609903 15:85351589-85351611 ACAGTTTGAAAGGGAAAACCAGG - Intergenic
1133630649 16:7617142-7617164 ACAGCTTGTTAGCTTAAAGCAGG + Intronic
1135686189 16:24500099-24500121 AGAGCTTGTAGGGGTAAAGCTGG + Intergenic
1139201125 16:64978168-64978190 ACAGTTTTTGAGTGTAAAACAGG - Intronic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140610585 16:76593773-76593795 AGAGCTTCTCAGGGTAAAGCAGG - Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1144623647 17:16833553-16833575 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1144882782 17:18439163-18439185 ACAGCTGGTAAGGGCAGAGCAGG + Intergenic
1145149449 17:20505223-20505245 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1146771764 17:35575188-35575210 TCAGCTTTTAAGGATAAAAAAGG - Exonic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1148581022 17:48743811-48743833 TCAGCTTAGAAGGGTAAAGCAGG - Intergenic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
1156024476 18:32636196-32636218 ACAGATTGTAAGCAAAAAACTGG - Intergenic
1156917657 18:42480622-42480644 ACAGCGTGTTAGGGGAAAACAGG - Intergenic
1157444097 18:47731892-47731914 ACAGCTTGTAGGGGACAGACAGG + Intergenic
1157537781 18:48472984-48473006 ACAGCTGCTAAAGGTAATACTGG + Intergenic
1158189197 18:54806631-54806653 ACATCTTTCAAGTGTAAAACAGG + Intronic
1162891329 19:13735342-13735364 AGAGCTTGTAATGGTAGAACTGG - Intronic
1163155188 19:15436367-15436389 ACAGCTGGAAAGGGTGAAACAGG - Intronic
1165916156 19:39261842-39261864 ACAGCTTGTAGGTGTGAAATGGG - Intergenic
1166923750 19:46251152-46251174 ACAACTAGTAATGGTAAACCTGG + Intergenic
926468424 2:13220972-13220994 ACGGCTTGTAAGAATAGAACTGG - Intergenic
927277390 2:21273401-21273423 TCAGCTTGTACGAGTAAAGCAGG - Intergenic
928233725 2:29522191-29522213 ACAGCTTGTAAGGAGTAGACTGG - Intronic
929410441 2:41693139-41693161 ACAGCTTGTAAGAGTAATGTGGG - Intergenic
932371150 2:71189125-71189147 CCAGCTTGGAAGGCTAAAGCAGG - Intronic
932726213 2:74182003-74182025 TGAGGTTGTTAGGGTAAAACGGG - Intergenic
934028561 2:88020438-88020460 ATAGCTTCTAAGTGTACAACTGG + Intergenic
936125827 2:109788541-109788563 TCAGGTTCTCAGGGTAAAACAGG - Intergenic
936218866 2:110582927-110582949 TCAGGTTCTCAGGGTAAAACAGG + Intergenic
936269010 2:111034091-111034113 ACAGCTGGTAGAGGTAAAGCCGG - Intronic
937916589 2:127102253-127102275 ACAGCTTGTAAGGGACCAGCTGG + Intronic
938722438 2:134078591-134078613 ACAGCTGCTAAGAGAAAAACAGG + Intergenic
939117876 2:138081382-138081404 ACAAAATGTAAGGGTAAGACTGG - Intergenic
940521761 2:154760084-154760106 ATAGCTGGTAAGAGTATAACTGG - Intronic
944907406 2:204276287-204276309 TCAGCTTGGAAGGGTAAAGCAGG - Intergenic
947433847 2:230055101-230055123 ACAGCCAGTAAGTGTAGAACTGG - Intronic
947880712 2:233508737-233508759 ATAGTTTGCAAGGGAAAAACAGG + Intronic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1177622845 21:23619319-23619341 ACAGCTTGTAAAGGCAGAATTGG - Intergenic
1179094538 21:38300405-38300427 ACAGCTTGCAGGGTTAAACCTGG - Exonic
1182991280 22:34770323-34770345 ACAGCTTGTAAGAGTCACACAGG + Intergenic
1183042132 22:35189909-35189931 ATAGCTAGTAATGGTAGAACTGG + Intergenic
949512284 3:4776920-4776942 ACACCTTGAAAGGGGAAAAAGGG + Intronic
949615686 3:5751622-5751644 ACAGTTTGTATGGGTAAACATGG - Intergenic
950381726 3:12621223-12621245 ACAGCTTGTAAGTGGCAAACTGG + Intronic
950915402 3:16639876-16639898 ATAGCTTTTGAGGGTAAAAGGGG - Intronic
955720285 3:61873207-61873229 GCAGTTTGTAAGCGGAAAACTGG + Intronic
956350092 3:68325166-68325188 ACAACTAGTAAGGGACAAACAGG - Intronic
957030911 3:75240010-75240032 ACAGATTTGAAGGGTAAAATGGG + Intergenic
958716122 3:97783337-97783359 ACATGTGGTAAGGGTAAATCAGG + Intronic
959822433 3:110752474-110752496 ACAGGTTATAGTGGTAAAACAGG - Intergenic
962595481 3:136938801-136938823 ACAGCTCCTAAGGGAAAAACAGG - Intronic
964441981 3:156721181-156721203 ACACCTTGAAAGGGAAAAAAGGG + Intergenic
970626345 4:17888248-17888270 ACAGATTAGAAGGGTAAAAGGGG + Intronic
970821846 4:20225786-20225808 ACAATTTGTAAGTTTAAAACTGG + Intergenic
970852520 4:20617982-20618004 ACAGCCGGTAAAGGTAAGACAGG - Intronic
978180095 4:105783639-105783661 AAAGAATGTAAGGGTTAAACGGG - Intronic
979386346 4:120069348-120069370 ACAGCTTATAAGGATAAAGGAGG + Intergenic
981973499 4:150694706-150694728 ACAGCATTCAAGGTTAAAACAGG + Intronic
982063934 4:151634669-151634691 ACAAATGGTAATGGTAAAACTGG + Intronic
984292443 4:177812635-177812657 ACAGCATGTAGGTGGAAAACAGG - Intronic
986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG + Intronic
987653906 5:20781127-20781149 AGAGCTACTAAGTGTAAAACTGG - Intergenic
988045551 5:25947386-25947408 ACAGCATGGAAGTGAAAAACAGG + Intergenic
994147824 5:96414158-96414180 ACAGCTGGTAAGAGCAGAACTGG - Intronic
994330941 5:98505667-98505689 ATATCTTGTAAAGGTAAAATCGG + Intergenic
995869276 5:116727059-116727081 ACAGCTTGTCAGTGTAGTACTGG + Intergenic
996584047 5:125064824-125064846 ACAGCTTATCATGGGAAAACTGG + Intergenic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
1000129491 5:158282280-158282302 ACAGCTAGTAAGTGTAGAAGTGG + Intergenic
1001755036 5:174161845-174161867 ACAGCTAGTCAGGGCAAAATGGG + Intronic
1005659943 6:27987215-27987237 ATAGCTTGAAAGGCTAAAAATGG + Intergenic
1006717230 6:36128342-36128364 ACAGCTGGTAAGGGCAGAGCTGG - Intronic
1007258613 6:40546113-40546135 ACAGCTTGGCTGGGCAAAACGGG + Intronic
1008095637 6:47336812-47336834 ACAGATAGGAAGGGTTAAACAGG - Intergenic
1012010966 6:93784798-93784820 ACAGCTTCAGAGGATAAAACAGG + Intergenic
1017047703 6:150362950-150362972 ACCGCTTGTAAGGGTACAGTTGG - Intergenic
1027801131 7:82750786-82750808 ACTGCTTGAAAAGATAAAACTGG - Intergenic
1030237596 7:107283091-107283113 ACAGCTTTTAAGACTAAAAAGGG - Intronic
1030564031 7:111129003-111129025 ACATCTTGTAAGGGTTAATGTGG - Intronic
1036436540 8:8739461-8739483 ACAGCATGTAAGTGTGAAGCTGG - Intergenic
1036695614 8:10972931-10972953 ACAGGTTGTAAGGGAAAGCCTGG + Intronic
1038108345 8:24464026-24464048 ACAGCTTGTACAGCTAGAACAGG - Intronic
1039518702 8:38153444-38153466 ACAGCTTTTAAGGGGGAAAGTGG - Intergenic
1039611667 8:38924148-38924170 ACATCTTGTAAGTGAAAACCGGG - Intronic
1042194751 8:66222527-66222549 ACATCTGGTAAGGGGAGAACTGG - Intergenic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1043411422 8:80001167-80001189 TCAGCTTGTAAGAATAAGACAGG + Intronic
1047298780 8:123594803-123594825 ACAGCTAATAATGGTAGAACTGG - Intergenic
1048743956 8:137592408-137592430 ACAGCTTGAAAGGGCAGAGCTGG - Intergenic
1053599946 9:39600862-39600884 ATAGCTTCTAAGTGTACAACTGG - Intergenic
1054253579 9:62741522-62741544 ATAGCTTCTAAGTGTACAACTGG + Intergenic
1054567695 9:66776021-66776043 ATAGCTTCTAAGTGTACAACTGG + Intergenic
1056071533 9:82992247-82992269 ACTACTTGTATGGGTAAGACAGG + Intronic
1056143825 9:83709400-83709422 ACAGCATGACAGGGAAAAACAGG - Intergenic
1058809694 9:108627477-108627499 ACATTTTGCAAGGGAAAAACTGG - Intergenic
1186045016 X:5526432-5526454 ACATCCTGTACAGGTAAAACTGG + Intergenic
1186915525 X:14215371-14215393 ACAGCTTGTAAAGGGCAAATGGG + Intergenic
1190495449 X:51024297-51024319 ACAGGTTATAGTGGTAAAACAGG + Intergenic
1193065221 X:77252685-77252707 ATAGCTTTTAGGGGTAAAAGTGG - Intergenic
1194733510 X:97484275-97484297 ACAACTAGTAATGGTAAAAACGG - Intronic
1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG + Intronic
1199020483 X:142871746-142871768 ACTGCTTGTGAGGGAAAAATGGG + Intergenic