ID: 1072829921

View in Genome Browser
Species Human (GRCh38)
Location 10:98646926-98646948
Sequence GTTTATTTACTATGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 390}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072829921 Original CRISPR GTTTATTTACTATGAAAAAC TGG (reversed) Intronic
905643091 1:39605607-39605629 ATTTATTTATTATGAGAAACTGG + Intergenic
906429292 1:45741926-45741948 GTTTCTTTAATATGAAAATAAGG - Intronic
907546109 1:55261248-55261270 GTTTATTTAAGATAAAAATCTGG - Intergenic
909031967 1:70552718-70552740 GTTTATTTTCTCTGTAAAACTGG + Intergenic
909588806 1:77321994-77322016 TTTTATGTACTATGAAAACAGGG + Intronic
910603759 1:89060107-89060129 GTTTATTAACTATTAACTACAGG - Intronic
912634375 1:111278281-111278303 GTCTATTTCCTATGCAAAATAGG - Intergenic
912769381 1:112449248-112449270 ATTGAATTACTGTGAAAAACTGG - Intronic
915861283 1:159447325-159447347 GTTAGTTTTCTATGAAATACAGG - Intergenic
916019671 1:160780696-160780718 GTTTCTTACCTGTGAAAAACAGG + Intergenic
917468129 1:175302016-175302038 GGTTATATACTATGATCAACTGG + Intergenic
917822787 1:178782309-178782331 CTGTCTTTACTGTGAAAAACTGG - Intronic
918642479 1:186860177-186860199 ATTAATTTATTATGACAAACAGG + Intronic
919311344 1:195913991-195914013 GTTTATTTACTTTTAAAAATAGG + Intergenic
920063768 1:203249486-203249508 GTTTATTTAATTTAAAAAAATGG - Intronic
920717185 1:208351223-208351245 GTTAATTTATTATTAAAAGCAGG + Intergenic
921307907 1:213815328-213815350 GTTTATTAACTATGCTCAACAGG - Intergenic
921669414 1:217909612-217909634 CTTTATGTATTATGTAAAACAGG - Intergenic
921818216 1:219587669-219587691 ATTTATTTATTTTGAAAAACTGG - Intergenic
921853070 1:219951409-219951431 ATTTATTTACTTTTAGAAACAGG + Intronic
922122791 1:222689733-222689755 GTTAATTTATTATTAAAGACAGG + Intronic
922375803 1:224963983-224964005 TTTTATTTACCATGCAATACAGG - Intronic
923426060 1:233871103-233871125 GTATATTTACCATGTAAAGCAGG - Intergenic
923791661 1:237116588-237116610 ATTTATTTATTATGAGAAATGGG + Intronic
923813356 1:237345312-237345334 ATCTATATACTATGAAAAACTGG - Intronic
924211054 1:241767729-241767751 GATTATTTCCTTTCAAAAACTGG - Intronic
1063806479 10:9649226-9649248 GTTTATTTATGATGATAAACTGG - Intergenic
1064234062 10:13557124-13557146 TTTAATCTACCATGAAAAACTGG + Intergenic
1065379315 10:25073566-25073588 GGATATTTACTTTGAAAAAATGG + Intergenic
1065403231 10:25330945-25330967 GTTTATTTACTTTGGAGAAAGGG + Intronic
1066128386 10:32365016-32365038 CTTTCTTTACTATGTAAACCAGG - Intronic
1067308357 10:45088995-45089017 TTTTATTTATTTTCAAAAACAGG + Intergenic
1068193350 10:53683435-53683457 TTTTTATTACTATGAAAATCTGG - Intergenic
1068225154 10:54098950-54098972 GTTTTAGAACTATGAAAAACTGG + Intronic
1068291885 10:55013761-55013783 TTTTATTTCCTATGGATAACAGG - Intronic
1068464655 10:57374114-57374136 ATTTTTTTATTATGAAAAAATGG + Intergenic
1069125727 10:64630030-64630052 GTTAATTTATTATTAAAAAAAGG + Intergenic
1071025722 10:81110758-81110780 TGTTATTTAATGTGAAAAACAGG + Intergenic
1072204883 10:93194933-93194955 GTTTTATTACTATGAAACAAAGG + Intergenic
1072215059 10:93280967-93280989 GTTTCTTTCCTATGCAAAAGAGG + Intergenic
1072829921 10:98646926-98646948 GTTTATTTACTATGAAAAACTGG - Intronic
1073292591 10:102420720-102420742 GTTTAGCGACTTTGAAAAACGGG - Exonic
1073724576 10:106215093-106215115 CTTTATTAACTTTGGAAAACTGG + Intergenic
1073918636 10:108433786-108433808 GGTTATTTACAAAGAAAAAGAGG + Intergenic
1074243754 10:111666900-111666922 GTATATTTACTGTGAAAACTTGG - Intergenic
1074324488 10:112435779-112435801 GGCTATTTACAAAGAAAAACTGG + Intronic
1074335225 10:112567574-112567596 CATTATTTACTATGAGAAAAAGG - Intronic
1078322663 11:10350701-10350723 GTTTTTTTAATATGTAAAAATGG + Intronic
1079124114 11:17706754-17706776 ATTTATTTACTTTTAAAAACTGG - Intergenic
1079598136 11:22278443-22278465 ATTTGTTTTCTATGAAAACCTGG + Intronic
1080396254 11:31892957-31892979 GATTTTTTATTATAAAAAACAGG + Intronic
1081011420 11:37817634-37817656 GTCTATTTACTTTGAGAAAATGG - Intergenic
1081075924 11:38673571-38673593 GTTTATATACTAAGAAAAATAGG - Intergenic
1083037433 11:59652569-59652591 GTAGAATTACTTTGAAAAACTGG - Exonic
1083461598 11:62816570-62816592 GTTTTTTTACTATGAAAATTTGG - Intronic
1086226456 11:84516863-84516885 GTTTATTTGCTATGATCAACTGG + Intronic
1087092461 11:94287883-94287905 TTTTACTTACAATAAAAAACTGG + Intergenic
1087520288 11:99224869-99224891 ATGTATTTATTTTGAAAAACTGG + Intronic
1087955774 11:104286249-104286271 GTTTATCTACTTTGAGAATCAGG + Intergenic
1088294877 11:108281969-108281991 ATTTATTTATTTTGAAAGACAGG + Intronic
1088468149 11:110164152-110164174 ATTTCTTTACTATCAAGAACAGG - Intronic
1088533436 11:110835339-110835361 GTTTCTTCACTATGCACAACAGG + Intergenic
1092464712 12:8720410-8720432 CTTTATTTACTATTATACACTGG - Intronic
1092681902 12:10992582-10992604 GTTTATTTTCTTTAACAAACAGG + Intronic
1092729338 12:11513656-11513678 GATTATTTAATCTGAAAATCAGG - Intergenic
1092746637 12:11678644-11678666 ATTTATTTATTATGAGAAATTGG + Intronic
1092809390 12:12258126-12258148 ATTTATTTATTTTGAAAGACAGG + Intronic
1093031181 12:14290136-14290158 ATTTTTTTAATATGATAAACTGG + Intergenic
1093300896 12:17452951-17452973 TTTTATTTCCTTTCAAAAACAGG - Intergenic
1093342066 12:17989502-17989524 CTTTTTTTACTTTCAAAAACAGG + Intergenic
1093863157 12:24192728-24192750 GTTCATTTAGAATGAAAAACTGG - Intergenic
1094523016 12:31213278-31213300 CATTATTTACTATAAAAATCTGG + Intergenic
1095750592 12:45706376-45706398 ATTTATTTATTTTGAAAAACTGG + Intergenic
1099326358 12:81220121-81220143 GTGTATATACTAAGAAAAAATGG + Intronic
1101006249 12:100403873-100403895 ATTTATTTATTATGAAATTCAGG + Intronic
1101905162 12:108819234-108819256 TTTTCTTCACTATGTAAAACAGG + Intronic
1102588358 12:113939298-113939320 ATTTATTTATTTTGAAAGACAGG - Intronic
1103139969 12:118540028-118540050 ATTTATTTATTAAGAAATACAGG + Intergenic
1104663637 12:130631653-130631675 ATTTTTTTACTTTGGAAAACTGG + Intronic
1105336438 13:19474450-19474472 GTTTATTTTTTATGAGAAATTGG - Intronic
1106995223 13:35472641-35472663 TTTTATTTTCTATGAGAAAGAGG - Intronic
1107578601 13:41755353-41755375 GGTTATTTACTATGTAAAGTTGG - Intronic
1107584844 13:41834230-41834252 GTTTATCTACTGTAAAAAACTGG + Intronic
1107846479 13:44519258-44519280 TTTCATTTACTATGAAAAAAAGG - Intronic
1108047586 13:46397790-46397812 GTTGATTTATTATGAGAAATTGG - Intronic
1108236531 13:48413528-48413550 GTTTAATGACTATGAAACAGGGG + Intronic
1108468698 13:50745817-50745839 GTCTATTTAATAGGAAAGACAGG + Intronic
1109085671 13:57968522-57968544 GGTAATTTACTAAGAAAAAGAGG + Intergenic
1109112734 13:58343808-58343830 GGTTTTTTTCTGTGAAAAACTGG + Intergenic
1109825157 13:67709476-67709498 GTTAATTTACTTTGAAAGTCAGG - Intergenic
1110153429 13:72283414-72283436 GTTTATTTTCTTTAAAAAATGGG - Intergenic
1110395358 13:75023810-75023832 GTTCACTTTTTATGAAAAACTGG - Intergenic
1112503956 13:99963183-99963205 GTTTATTTATTATGAAACAAAGG - Exonic
1112535565 13:100251664-100251686 GATTATTTGCTAAGAAAAAATGG + Intronic
1113154699 13:107306587-107306609 TTTTATTTTCAATAAAAAACTGG + Intronic
1113477168 13:110592288-110592310 ATTTATTTATTTTTAAAAACAGG + Intergenic
1114164003 14:20200085-20200107 ATTTATTTAACCTGAAAAACAGG - Intergenic
1116421795 14:44741801-44741823 GTTTATCTATTATGAAAGATTGG + Intergenic
1116611726 14:47082654-47082676 ATTTATTTTGTATGAAAAACCGG - Intronic
1117275495 14:54188974-54188996 TATTTTTTACTAAGAAAAACTGG - Intergenic
1117600442 14:57368382-57368404 GCTTATTTACTATGATCAAGTGG + Intergenic
1117685537 14:58249351-58249373 GTTTATTTATTTTAAAAAAGAGG + Intronic
1118134015 14:63001638-63001660 GTTTATTAAATTTGAACAACTGG - Intronic
1119112591 14:71988964-71988986 GTTTTTTTAAAATAAAAAACAGG + Intronic
1119449984 14:74701317-74701339 GTTAATTTACAAAGAAAAAGAGG + Intronic
1119606406 14:76021852-76021874 TGTAATTTACTATGAAAATCTGG - Intronic
1120162814 14:81163587-81163609 GTTGATTTACTAATAAAATCAGG - Intergenic
1120174642 14:81280129-81280151 GTTTATTTTTTATGATAAAAAGG + Intronic
1120370245 14:83625003-83625025 ATGTATTTGCTATGAAAAACGGG - Intergenic
1120737394 14:88068265-88068287 GTTTACTTACCATAAAAGACTGG + Intergenic
1120754620 14:88230775-88230797 GCTTACTAACTATGAAATACCGG + Intronic
1123223732 14:106880373-106880395 GTTAAATTACAATGAAAAAATGG + Intergenic
1124268217 15:28256434-28256456 GTTTATGTATTTTTAAAAACTGG + Intronic
1125253544 15:37734675-37734697 CATTATTTAATAGGAAAAACAGG + Intergenic
1125435586 15:39641490-39641512 GTTTATTGACTATAATTAACAGG + Intronic
1126207670 15:46063456-46063478 TTTTACTTCCTATGAAAACCTGG - Intergenic
1126489181 15:49217074-49217096 TTTTATTTACTGTTAAAACCTGG + Intronic
1127522808 15:59760034-59760056 GTCTTTTAACTTTGAAAAACTGG - Intergenic
1128602166 15:69005189-69005211 GTTGATTTAACATGAAAATCTGG + Intronic
1128976498 15:72157998-72158020 GTTTAACTACTGTGTAAAACAGG - Intergenic
1130085496 15:80775445-80775467 GTTGTTTTACTATTAAAAATAGG + Intergenic
1131929471 15:97424400-97424422 GTTTCTTTTATATGAAATACAGG + Intergenic
1132084739 15:98898765-98898787 TTTTGTTTACTATGAGAAAAAGG + Intronic
1135333885 16:21584594-21584616 GATTATTTTCTATAAAAAGCTGG + Intergenic
1136621216 16:31429802-31429824 GTTTATTACCAATGAGAAACAGG - Intergenic
1136988039 16:35130179-35130201 GTTTCTTTAAAATGAAAGACAGG - Intergenic
1137380737 16:47997181-47997203 ATTTATTTACTTTTAAAAAGAGG - Intergenic
1137528278 16:49257033-49257055 GTTTAATTGATATGAAAAAAGGG + Intergenic
1137561339 16:49504263-49504285 GAATTTTTACAATGAAAAACAGG + Intronic
1138034871 16:53594042-53594064 ATTTATTTACTTTTAAAAATAGG + Intergenic
1138464277 16:57176327-57176349 AATTATTTACTAGGAAAAATGGG - Intronic
1140286950 16:73612500-73612522 GTTTATTTATTATTTGAAACTGG - Intergenic
1140713484 16:77700400-77700422 GTTTTTTTCTTATGAAAAATTGG - Intergenic
1142777458 17:2152253-2152275 GTTTATTTAAAATGAAAGAGGGG - Intronic
1143616684 17:8055621-8055643 GTTTATTTGCTTTTAAAAAAAGG - Intergenic
1144600564 17:16608941-16608963 ATCTATTTACTATGAAAATGGGG + Intergenic
1146162774 17:30568968-30568990 GTTTATCTCCTATGGAAAAAGGG + Intergenic
1147471082 17:40661814-40661836 GTTTATTTACCATGAGAAACTGG - Intronic
1148705830 17:49631303-49631325 GTATATTTTCTATTAAAAAATGG - Intronic
1148937166 17:51172742-51172764 TTATATTTCCTATAAAAAACTGG + Intergenic
1149962020 17:61120926-61120948 GTTTATTTATTAAGGAAACCGGG + Intronic
1150365438 17:64578690-64578712 TTTTATTTATTATCAAAAAAGGG + Intronic
1150371238 17:64640007-64640029 GTTTAGTTAATAGGGAAAACTGG + Intronic
1150777976 17:68097087-68097109 GTTTAGTTACTTTAAAAAAAAGG + Intergenic
1153493404 18:5672893-5672915 GTTTTTTTAATTTTAAAAACAGG + Intergenic
1153780984 18:8495000-8495022 GGTTATTTATTGTGAAAAAATGG + Intergenic
1153989357 18:10382359-10382381 GTATGTTTACTATAAAAAAATGG - Intergenic
1155555539 18:27015256-27015278 GTTTCTTTACACTGAAAAATTGG - Intronic
1155619165 18:27756164-27756186 ATTTAAATTCTATGAAAAACTGG + Intergenic
1155688593 18:28587128-28587150 GTCTATTTCTTATGATAAACTGG - Intergenic
1156965858 18:43091104-43091126 GTTTATTTACTTTAAAATTCAGG - Intronic
1159063933 18:63547891-63547913 GATTATCTACAATGAAAAATGGG + Intergenic
1159249427 18:65854480-65854502 ATTTATTTAATATGCTAAACTGG - Intronic
1159661372 18:71099587-71099609 GTTTATTTACATTTAAAAATAGG - Intergenic
1159701458 18:71633233-71633255 AATTATTTAATATGAAAAACTGG - Intergenic
1164297114 19:23921418-23921440 TTTTCATTACTGTGAAAAACTGG + Intronic
1167855324 19:52233086-52233108 TTTTTTTTAATATGAAAAAAAGG + Intergenic
1168496865 19:56860370-56860392 GTTTGTTTTCTAAGAAAAAGGGG - Intergenic
925580351 2:5404205-5404227 GGTAATTTACAAAGAAAAACAGG + Intergenic
926025708 2:9542366-9542388 ATTTATTTATTTTTAAAAACAGG - Intronic
926379614 2:12273249-12273271 TATTATTTACTATGAGAGACTGG - Intergenic
926612514 2:14960820-14960842 GTTCATTGACTATGAAACAATGG - Intergenic
926945936 2:18187426-18187448 GTTTATTTACTATAAAACTTTGG - Intronic
927620509 2:24651947-24651969 GTGTAGTTACTGTGGAAAACTGG + Intronic
927822084 2:26275976-26275998 CAATATTTACTATGAAATACTGG - Intronic
928789127 2:34930050-34930072 GCTTATTAACTTTGATAAACTGG - Intergenic
929069797 2:38018728-38018750 CTTTATTTATTATTAAAAACTGG - Intronic
929180110 2:39029323-39029345 GTTTATTTAAAATTAAAAATTGG + Intronic
929479324 2:42289197-42289219 GTTAAATTACTCTGAATAACTGG - Intronic
929835854 2:45398155-45398177 GTTAATTTACTGTAAAAAAACGG - Intronic
930066748 2:47333441-47333463 TTTTATTTGCTTTTAAAAACTGG + Intergenic
930280170 2:49360414-49360436 ATTTATTTAGTTTAAAAAACGGG + Intergenic
930708027 2:54523575-54523597 GCTTATTTACTATGGAAACTTGG + Intronic
930788073 2:55292123-55292145 TATTATTTACTAAGAAAACCAGG + Intronic
931020321 2:58037421-58037443 GTTTATTTTCTATGGGAAAGGGG + Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932458280 2:71863980-71864002 TTTTATCTACTATTAAAATCAGG - Intergenic
932980903 2:76664983-76665005 GTTTATTTAATTTTTAAAACTGG + Intergenic
933012370 2:77083737-77083759 GTTTTGTTACTATGAAAGAAAGG - Intronic
933528276 2:83472237-83472259 CTTTATTTTCTTTGAAAAAATGG - Intergenic
935471397 2:103464884-103464906 ATGTATTTACAAAGAAAAACAGG + Intergenic
935948395 2:108306597-108306619 GTTTATTTTTTAAGAAAAGCTGG - Intronic
936850508 2:116891995-116892017 GTTTATTTCCTTTAATAAACTGG + Intergenic
937724439 2:125145102-125145124 GTTTATTTATTTTTAAAAAATGG + Intergenic
938301884 2:130220950-130220972 GTCTATTAACTATGAATAATTGG + Intergenic
939172805 2:138715500-138715522 GTTTATTTACCCTGATAAGCAGG - Intronic
940061782 2:149579107-149579129 ATTTATTAAAAATGAAAAACAGG + Intronic
940160879 2:150712085-150712107 TTCTTTTTACTATGAAAAAATGG + Intergenic
940701955 2:157056490-157056512 GTTCATCTACTATAAAAAAAGGG + Intergenic
941043885 2:160651325-160651347 GTTAATTTTCTATAAAGAACAGG + Intergenic
941472627 2:165907776-165907798 GTTCATTTACTATGAAAGAATGG + Exonic
942263958 2:174201628-174201650 GTTTCTTTAGTATGCAAAATGGG + Intronic
942375906 2:175337377-175337399 GATAATATACTATGAACAACTGG - Intergenic
943403333 2:187445933-187445955 GTTCATTCACTTTGAAAAATTGG - Intronic
944383974 2:199143568-199143590 CTTTGTTTACTATGAAAATTGGG - Intergenic
944656782 2:201883495-201883517 GGTTATTTGCCATGAAAACCAGG + Intronic
944820372 2:203424133-203424155 TTTTATTTAGTCTGGAAAACTGG - Intronic
945491155 2:210456933-210456955 GTGTATTTCTCATGAAAAACAGG + Intronic
945668087 2:212766982-212767004 GTTTATTTACAATGAAAGCTTGG - Intergenic
946783109 2:223213238-223213260 AATTATTTGGTATGAAAAACGGG + Intergenic
947087335 2:226468055-226468077 GTCTATTTTCTTTGCAAAACTGG - Intergenic
947570373 2:231228950-231228972 GTTTATTTGATCTGCAAAACTGG - Intronic
1169818298 20:9681865-9681887 GTTTATAGACTAACAAAAACAGG - Intronic
1170362956 20:15567481-15567503 GTTTATATACTATGATAATCTGG - Intronic
1170951930 20:20944801-20944823 TCATATTTAGTATGAAAAACAGG + Intergenic
1171504312 20:25621395-25621417 GAGTAATTACCATGAAAAACAGG + Intronic
1174211316 20:48880742-48880764 GCTTATTTACTAGGAAAGAAGGG + Intergenic
1174582818 20:51584571-51584593 GTTTATTAACTATGAAATGCTGG - Intergenic
1175425078 20:58859053-58859075 CATTATTTACAATGGAAAACTGG + Intronic
1176072219 20:63233172-63233194 GTTTATTCATTTTGAAAAATGGG + Intergenic
1176124126 20:63467662-63467684 GTTTATTGACTAAAACAAACTGG + Intronic
1176737119 21:10560657-10560679 GTTTATTTTTTATGAGAAATTGG + Intronic
1177489848 21:21808631-21808653 TATTATTTACTATGAAAAGCAGG + Intergenic
1177774120 21:25549301-25549323 CTTTATTTTCTCTGAAAAATAGG - Intergenic
1178553104 21:33558717-33558739 TGTTCTTTACTATGAAAATCTGG + Intronic
1178825290 21:36010514-36010536 GTTTATGTACTATGACCAAGTGG + Intergenic
1178889226 21:36507411-36507433 GTTTAATTACTATGTGAAAATGG + Intronic
1180563117 22:16638179-16638201 GTTTATTTTTTATGAGAAATTGG + Intergenic
1181392177 22:22591387-22591409 GCATATTTAATAGGAAAAACAGG - Intergenic
1182835741 22:33340108-33340130 GTTTATTTAATACGCACAACAGG + Intronic
1183336610 22:37251417-37251439 GGTAATTTACTAAGAAAAAGAGG + Intergenic
950975218 3:17234979-17235001 GTACATATACTATGAAAATCTGG - Intronic
952170495 3:30801381-30801403 TTTTATTCACACTGAAAAACTGG - Intronic
954013029 3:47659977-47659999 GTATAGCCACTATGAAAAACAGG + Intronic
954694196 3:52411761-52411783 GTTTGTTTACTAATGAAAACAGG + Intronic
956815611 3:72905551-72905573 GTTTATTGAAAATGAAAAATAGG - Intronic
957383749 3:79468467-79468489 ATTTAATTACTATGAAATATAGG - Intronic
957543886 3:81611905-81611927 GTTTTTGAATTATGAAAAACAGG + Intronic
957829647 3:85500284-85500306 GTTTATTTTCTATAAAAAAATGG + Intronic
958514864 3:95101132-95101154 GGTAATTTACAATGAAAAAGAGG - Intergenic
959227242 3:103601465-103601487 CTTTATTTACTAAGGAAAATGGG - Intergenic
959665480 3:108916334-108916356 TTTTATTTACTTTTAACAACTGG - Intronic
960336189 3:116420403-116420425 GATTATCTACTCTGAAAAAATGG - Intronic
960387848 3:117042707-117042729 ATTTGGTTACTTTGAAAAACAGG - Intronic
960622104 3:119647116-119647138 GTTTGTCTATTTTGAAAAACAGG - Intronic
962473381 3:135733318-135733340 GATTATTTACTATGATCAAGTGG - Intergenic
963550339 3:146713701-146713723 TTTTATGTACTATGAAAAAGTGG + Intergenic
963648935 3:147952450-147952472 GTTTATATAATAGTAAAAACTGG - Intergenic
964800262 3:160548865-160548887 GTGAAGCTACTATGAAAAACAGG - Intronic
965084337 3:164075135-164075157 GTTGATTTACCATGAAAATCTGG + Intergenic
965858880 3:173123276-173123298 GTTTCTTTATTATGAAAATATGG - Intronic
966079667 3:175985269-175985291 GTTAATTTATTATGATCAACTGG - Intergenic
966347947 3:178999734-178999756 ATTTATTTACTTTTAGAAACAGG - Intergenic
966560881 3:181319063-181319085 GTACATTTACTATGAAAATATGG - Intergenic
967641012 3:191862903-191862925 GTTTAATTTCTCTGAAAAATTGG + Intergenic
968403931 4:322930-322952 ATTTATTGAATAAGAAAAACCGG - Intergenic
970189812 4:13503832-13503854 GTTAATTTTCTAAGAAAAATGGG + Intergenic
970671899 4:18406352-18406374 ATTTATTGACTGTGAAAAGCAGG - Intergenic
970746941 4:19310109-19310131 GTTTATTTAGTATTCAACACTGG - Intergenic
971305421 4:25475953-25475975 TTTTCATTACTATGAACAACTGG + Intergenic
971430248 4:26557779-26557801 GTTAATTTACAAAGAAAAAGAGG + Intergenic
975094451 4:70441905-70441927 GTATATTTTCTTTGAATAACTGG - Intronic
975667209 4:76743947-76743969 TTTTATTTTCTTTGAAACACGGG - Intronic
976485894 4:85604382-85604404 GTTTACTTACTATTAAATAAAGG - Intronic
976559682 4:86487269-86487291 GTGTATTTCCTAAGAAAAAAAGG - Intronic
976615625 4:87072838-87072860 GTTTATTTAAAAAGAAATACTGG + Intronic
976898567 4:90142921-90142943 GTTATTTTATTCTGAAAAACTGG - Intronic
977403000 4:96558480-96558502 ATTTATTTTCTATGAAATACTGG + Intergenic
978266503 4:106832801-106832823 CTTTATTTATAATAAAAAACTGG + Intergenic
978339691 4:107709223-107709245 TTTGATTTACTTTGAAAAATTGG - Intronic
978890224 4:113817034-113817056 GTGCAACTACTATGAAAAACAGG - Intergenic
979210957 4:118102076-118102098 GTTTATTTATTGAGAAAAAATGG + Intronic
979563473 4:122126810-122126832 GTTATTTCACTATCAAAAACAGG + Intergenic
979681466 4:123464883-123464905 CTTTATTTCATATGAAAAAGTGG - Intergenic
979834918 4:125354180-125354202 ATTTATTACCTATGAAAATCTGG - Intronic
980435086 4:132761311-132761333 CTTTATTTACTCTGCAAAAGTGG + Intergenic
980764438 4:137281866-137281888 GTTCATTTAATATGTGAAACAGG - Intergenic
981594931 4:146409206-146409228 TTTTATTTACTGAGAAACACTGG - Intronic
981625657 4:146751898-146751920 GTTTATTTTCTCAAAAAAACAGG - Intronic
981799878 4:148643118-148643140 ATTCATTTACTAAGAAAAACAGG - Intergenic
982080906 4:151788745-151788767 TTTTATCTACTAGGAAAAATTGG + Intergenic
982556354 4:156870640-156870662 ATTTATTTAATACGAAATACAGG + Intronic
982912149 4:161156585-161156607 GTTTATGTATTAGGAAAAACTGG + Intergenic
983216987 4:165011018-165011040 GTTTGTTGACCATGAAAAGCAGG + Intergenic
983404064 4:167302832-167302854 CTTTATTGACAATGAACAACTGG + Intergenic
984564461 4:181311132-181311154 CTTTATTTATTATGACAAATAGG + Intergenic
984827343 4:183938319-183938341 GTTAATTTACTAACACAAACTGG - Intronic
984914218 4:184706356-184706378 GTTTTTTAAATAAGAAAAACTGG + Intronic
986121735 5:4844640-4844662 GTTTAATTTCTATGAAATGCAGG - Intergenic
986129451 5:4913452-4913474 GTTTTTTTAGTATGAAAAACTGG - Intergenic
986142323 5:5042561-5042583 GTTTTTTTACCATGAAAATATGG + Intergenic
986978846 5:13423017-13423039 GATGATATGCTATGAAAAACTGG - Intergenic
987686583 5:21212050-21212072 GTTTATTGACTATTAGAAAGTGG - Intergenic
988182196 5:27810955-27810977 TTATATTTACTATGAGAAAAAGG - Intergenic
988210261 5:28194650-28194672 GTTTATTTAAAAAGCAAAACAGG - Intergenic
988568141 5:32337380-32337402 GTTGATTTACCATGAAAATCTGG + Intergenic
988927427 5:36003745-36003767 ATTTATTTCCTATGGAAAAATGG + Intergenic
989720354 5:44520874-44520896 GCTTTTTCACTATGAAAAACTGG + Intergenic
990001965 5:50904312-50904334 GTGTATTTTATATGTAAAACAGG - Intergenic
990201646 5:53382827-53382849 GTAAACTTCCTATGAAAAACTGG + Intergenic
990285046 5:54292799-54292821 GTTTTTTTAATATGAGAAACAGG - Intronic
990718992 5:58672045-58672067 GTATATTTACTATAAAATTCTGG - Intronic
990787816 5:59442344-59442366 GTTTATCTATTATGAAAACTTGG - Intronic
992832863 5:80612067-80612089 GTTTAATCACTTTGGAAAACTGG + Intergenic
993173538 5:84452203-84452225 GAATATTTACTAAGAAAACCAGG - Intergenic
993436257 5:87899449-87899471 GTATATTTAGTGTGAAGAACTGG - Intergenic
993472683 5:88324987-88325009 ATTTATCTAGTGTGAAAAACTGG + Intergenic
993583183 5:89689717-89689739 GTTAATATATTAGGAAAAACAGG - Intergenic
995098368 5:108267941-108267963 GTTTATTTATAATGATAAACAGG + Intronic
995860275 5:116633777-116633799 GTTTATTTATAAAGAAAAAAAGG - Intergenic
996034997 5:118749078-118749100 CTTTATTTAGTTTCAAAAACAGG - Intergenic
996185607 5:120470600-120470622 GTTTAATAACCATGAAAAGCTGG - Intronic
996486082 5:124036295-124036317 GTCTCTTTATTAGGAAAAACAGG - Intergenic
997035530 5:130186582-130186604 GTTTATTTAAAATAAAACACAGG + Exonic
998245727 5:140502513-140502535 CTCTCTTTATTATGAAAAACAGG - Intronic
1000106050 5:158059801-158059823 GTTTCTTCACTTTAAAAAACTGG + Intergenic
1000385793 5:160673591-160673613 TTTTATTTTCTATGAATAATAGG + Intronic
1000426764 5:161100257-161100279 TTTTATTTACTATGCCAAAGAGG - Intergenic
1000622052 5:163497005-163497027 GTTGATTTACTATGAGGAATTGG + Intergenic
1000632199 5:163603319-163603341 AGTTAACTACTATGAAAAACTGG - Intergenic
1001940956 5:175739063-175739085 GCTTATTTCCTCTGAAAAATGGG - Intergenic
1003348233 6:5291150-5291172 GTGCATTTACCATGAAGAACAGG + Intronic
1003591280 6:7438976-7438998 GTTTCTTTATTGTGAAAAAAAGG + Intergenic
1006658684 6:35620356-35620378 GAGTATGTAGTATGAAAAACTGG - Intronic
1007058260 6:38910646-38910668 GTTTCTTTACTTTGAAAATTTGG + Intronic
1008196855 6:48534977-48534999 ATCCATTTACTTTGAAAAACAGG + Intergenic
1008356346 6:50558467-50558489 ATTTATATACTAGGAAAAGCTGG + Intergenic
1008651530 6:53568660-53568682 TTTTTTTTAGTAAGAAAAACTGG + Intronic
1008892885 6:56515659-56515681 TTTTATTTTCTAGAAAAAACTGG - Exonic
1009055767 6:58333028-58333050 GTTTAATTATTATAAAAAATAGG - Intergenic
1009235404 6:61117572-61117594 GTTTAATTATTATAAAAAATAGG + Intergenic
1010155408 6:72786651-72786673 GTTTATTTACTTCGCAATACTGG + Intronic
1010284265 6:74056893-74056915 ATTTATTAACTAGGGAAAACTGG - Intergenic
1011123628 6:83982727-83982749 GTTGATTTAGCATGAAAATCTGG - Intergenic
1012576553 6:100808354-100808376 GTTTAGTTACAATGAAAATCTGG - Intronic
1013408323 6:109861901-109861923 ATTTATTTATTTTGGAAAACGGG - Intergenic
1013914417 6:115317889-115317911 GCTGATTTCCTATTAAAAACTGG + Intergenic
1014158658 6:118141012-118141034 GTTAATTTACTATTAAAGAAAGG + Intronic
1015333143 6:132004591-132004613 ATATATATACTATGAAAAACTGG - Intergenic
1015410156 6:132885426-132885448 GTTTTTTTAATATGAAAACCTGG + Intergenic
1016125144 6:140391808-140391830 GTTGGTTTAATATGAAAATCAGG + Intergenic
1016166865 6:140956781-140956803 GATTATTTAAAATGAAAAACAGG + Intergenic
1016387306 6:143541106-143541128 CTTTATTTACAAAGAAATACTGG - Intronic
1016537112 6:145119997-145120019 GTGTAATTACTTTGGAAAACTGG - Intergenic
1017449716 6:154543307-154543329 GAATATTTATTATTAAAAACGGG + Intergenic
1017712278 6:157181486-157181508 GAGTATTTACTATGAACTACTGG - Intronic
1017761043 6:157568573-157568595 TTTTAATTAATATTAAAAACTGG - Intronic
1018575393 6:165254732-165254754 TTTTCTTTCCTATGAAAAAAAGG + Intergenic
1018620282 6:165724165-165724187 CTTTACTTACTAGGAAAAATTGG + Intronic
1019460906 7:1158777-1158799 GTTAAGTCACTATGGAAAACAGG + Intronic
1020338069 7:7079712-7079734 GTTTATTTATGCTGAAAAACAGG + Intergenic
1020547913 7:9556964-9556986 GTTTCTTTACTATGTTAAGCAGG - Intergenic
1020603284 7:10303471-10303493 GTATTTTTACTATGTAAAACTGG - Intergenic
1020668685 7:11078237-11078259 GTTTGTTAACTAGGAAAACCAGG + Intronic
1021055278 7:16039731-16039753 TTTTAATTAATATGAAAAATAGG - Intergenic
1021380908 7:19965073-19965095 GTTTATTAACTAAGAAATAATGG + Intergenic
1021405110 7:20257480-20257502 GTTCAATTTCTATGAAAGACTGG - Intergenic
1021683517 7:23158508-23158530 GATTATTTTCTATGAAAATTTGG + Intronic
1021747783 7:23760502-23760524 TTTTAATTTCTATGAAACACAGG + Intronic
1023115610 7:36859040-36859062 ATTTATTTATTGGGAAAAACAGG - Intronic
1023661205 7:42472828-42472850 CTTTATTTACAAAGAAAAACAGG + Intergenic
1028076845 7:86527010-86527032 GTGACTTTACTATTAAAAACAGG - Intergenic
1029299845 7:99572112-99572134 GTTTATTTACTCTGAAAAACAGG - Intronic
1030863025 7:114660189-114660211 GTTTATTTACTTAGACAAAAGGG + Intronic
1031679795 7:124657816-124657838 TATTATTTAATATGAGAAACTGG - Intergenic
1032739780 7:134727431-134727453 GTTTATGAACTAAGAAAAGCTGG - Intergenic
1033682497 7:143608575-143608597 GTGTATTTAAGATGAAAAACAGG + Intergenic
1033702392 7:143853338-143853360 GTGTATTTAAGATGAAAAACAGG - Exonic
1033736271 7:144225238-144225260 GTTTTTTTCCAATAAAAAACTGG + Intergenic
1033746783 7:144325717-144325739 GTTTTTTTCCAATAAAAAACTGG - Intergenic
1034926175 7:155124148-155124170 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926177 7:155124170-155124192 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926179 7:155124192-155124214 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926184 7:155124236-155124258 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926186 7:155124258-155124280 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926188 7:155124280-155124302 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926192 7:155124324-155124346 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926200 7:155124390-155124412 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926209 7:155124478-155124500 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926211 7:155124500-155124522 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926213 7:155124522-155124544 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926218 7:155124588-155124610 GTTGTTTGACTATGAGAAACCGG - Intergenic
1037068713 8:14616592-14616614 GTTTATTTATAAAGAGAAACTGG - Intronic
1037395443 8:18436831-18436853 GTTTTTTTACTCTTTAAAACTGG - Intergenic
1037888914 8:22611729-22611751 TTGTATTTACTATGAAAATTTGG + Intronic
1037931339 8:22882140-22882162 GCTTATTTTCTCTGAAGAACTGG - Intronic
1038302526 8:26367379-26367401 GCTTAAATACAATGAAAAACTGG - Intronic
1038603600 8:28974898-28974920 GTATATTAACTATGAAAATATGG + Intronic
1038825494 8:30995316-30995338 GTTTATCTACTATGACATTCTGG + Intergenic
1040706504 8:50134917-50134939 ATGTATTTACAATGAAAAAAAGG + Intronic
1041122135 8:54597252-54597274 GTTTTTCTACTTGGAAAAACAGG + Intergenic
1041367442 8:57123582-57123604 GTTTATTGAATATGAAATGCTGG + Intergenic
1041491795 8:58440895-58440917 GTTTGTGTCCTAAGAAAAACAGG - Intronic
1041538915 8:58961070-58961092 CTTCATATACTATGAAAAAATGG + Intronic
1041789509 8:61677252-61677274 GTTTTTTTCCTGTGAAGAACTGG + Intronic
1041979340 8:63837950-63837972 GGATATTTAGAATGAAAAACTGG + Intergenic
1042159399 8:65877152-65877174 GTTGATTTAGCATGAAAATCTGG - Intergenic
1043322995 8:79013681-79013703 GATTATTTATTATGACCAACTGG - Intergenic
1043676931 8:82968532-82968554 GTTTAATAAAAATGAAAAACTGG - Intergenic
1043753048 8:83965513-83965535 GTTTATTGAATTTGAAAAATTGG - Intergenic
1044048755 8:87472850-87472872 ATTTATTTAATATGACATACAGG - Intronic
1044581181 8:93827769-93827791 TTTTTTTTACTATGGAACACTGG + Intergenic
1045013579 8:97979860-97979882 ATGTATTCACTATGTAAAACAGG + Intronic
1045597355 8:103671371-103671393 GCTGATTTATTATGAAAACCTGG + Intronic
1045845186 8:106626197-106626219 TTTTTTTTACAAGGAAAAACAGG - Intronic
1046086379 8:109441389-109441411 ATTTATATACTATGAAATAATGG + Intronic
1046242791 8:111519344-111519366 TTGTATTCACTATGAAGAACAGG - Intergenic
1047971575 8:130089053-130089075 GTTCATGTACTAGGAAAGACAGG + Intronic
1048741854 8:137569992-137570014 GTTTTATTATTATGTAAAACAGG - Intergenic
1051099135 9:13501033-13501055 GTTTATTTACTCTGAGGAATTGG + Intergenic
1051280160 9:15434990-15435012 GTATCATTGCTATGAAAAACAGG - Intronic
1052552965 9:29974944-29974966 TTTTATTTATTTTGAAAATCAGG + Intergenic
1054945682 9:70793679-70793701 GTTTTGTAACTATGAAAACCTGG + Intronic
1055024175 9:71701792-71701814 GTATATTTACTATAATAAAAAGG - Intronic
1055126413 9:72723159-72723181 GTTTTTTTAGTTTAAAAAACTGG - Intronic
1055303645 9:74906397-74906419 GTTTGTTTACTATGAGTAAGAGG - Intergenic
1055606562 9:77976783-77976805 TTTTATTTACCTGGAAAAACTGG + Intronic
1058393359 9:104522023-104522045 TGTTATGTACTATGAACAACTGG - Intergenic
1059406461 9:114100893-114100915 TTTTTTTTCCTCTGAAAAACAGG - Intergenic
1059813263 9:117881508-117881530 TTTTGTTTACTTTGAAAATCTGG + Intergenic
1060228760 9:121812133-121812155 GTTCATTTAATCTGAGAAACAGG - Intergenic
1185977402 X:4737064-4737086 GTGTATTTGCTATAAAAAAATGG - Intergenic
1188173572 X:26959759-26959781 GTATATTTACTAAGTATAACAGG + Intergenic
1188192922 X:27194535-27194557 GTATAGCTACTATGGAAAACAGG - Intergenic
1188382311 X:29510251-29510273 ATGTATCTACTTTGAAAAACAGG + Intronic
1189048166 X:37615413-37615435 GTATATTTGCTATGAGAAGCTGG - Intronic
1189844265 X:45118044-45118066 GATTATTTAATAGGAATAACTGG - Intergenic
1190104111 X:47546525-47546547 GTTTATCTACCATGCAACACTGG - Intergenic
1191682439 X:63855086-63855108 CTTTCTTTACTATCAAAAAAGGG + Intergenic
1191907951 X:66114915-66114937 TTGTATGTAATATGAAAAACTGG + Intergenic
1192563360 X:72142343-72142365 ATTTATTTACTGTGATACACAGG + Intergenic
1194288905 X:92044443-92044465 GATTATTTATTAAGAAACACAGG - Intronic
1194824572 X:98545773-98545795 GTTTATTTACTATCAGTAAATGG + Intergenic
1194966322 X:100292794-100292816 CCTTATTGACTTTGAAAAACTGG - Exonic
1196516545 X:116619597-116619619 GCTTATGGACTATGAAAGACAGG + Intergenic
1197278909 X:124512216-124512238 GCTTATTTAATTTGACAAACTGG - Intronic
1197403643 X:126025255-126025277 GTTTATTTTCTAAAAAGAACAGG - Intergenic
1198384030 X:136110855-136110877 GTATATTGGCAATGAAAAACTGG - Intergenic
1199211740 X:145220196-145220218 GTATCTGTACTGTGAAAAACCGG + Intergenic
1199279920 X:145989415-145989437 GTTTGTTTAAAATGAGAAACTGG + Intergenic
1200301158 X:154978212-154978234 GTTTATTTAGTATCAAAATTTGG + Intronic
1200606425 Y:5269009-5269031 GATTATTTATTAAGAAACACAGG - Intronic
1201334815 Y:12869388-12869410 TGTGATTTATTATGAAAAACAGG - Intergenic
1201860656 Y:18593998-18594020 CTCTATCTCCTATGAAAAACAGG - Intergenic
1201872667 Y:18726382-18726404 CTCTATCTCCTATGAAAAACAGG + Intergenic
1202025153 Y:20513812-20513834 GTTCATTTACTATTAAAGAAAGG + Intergenic