ID: 1072831856

View in Genome Browser
Species Human (GRCh38)
Location 10:98666357-98666379
Sequence CAGTGTTAGATCATTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072831853_1072831856 15 Left 1072831853 10:98666319-98666341 CCACACAGTAATAGCAGGGGACT 0: 2
1: 1
2: 50
3: 290
4: 2127
Right 1072831856 10:98666357-98666379 CAGTGTTAGATCATTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072831856 Original CRISPR CAGTGTTAGATCATTGAGGC AGG Intronic
No off target data available for this crispr