ID: 1072831856 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:98666357-98666379 |
| Sequence | CAGTGTTAGATCATTGAGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072831853_1072831856 | 15 | Left | 1072831853 | 10:98666319-98666341 | CCACACAGTAATAGCAGGGGACT | 0: 2 1: 1 2: 50 3: 290 4: 2127 |
||
| Right | 1072831856 | 10:98666357-98666379 | CAGTGTTAGATCATTGAGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072831856 | Original CRISPR | CAGTGTTAGATCATTGAGGC AGG | Intronic | ||
| No off target data available for this crispr | |||||