ID: 1072837822

View in Genome Browser
Species Human (GRCh38)
Location 10:98735641-98735663
Sequence GGTCACGCCAATGCAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 1, 2: 7, 3: 92, 4: 555}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072837822_1072837827 13 Left 1072837822 10:98735641-98735663 CCATCTTTTGCATTGGCGTGACC 0: 1
1: 1
2: 7
3: 92
4: 555
Right 1072837827 10:98735677-98735699 TGGAGTCAAAGGAGATCATTTGG 0: 39
1: 47
2: 63
3: 62
4: 218
1072837822_1072837824 -7 Left 1072837822 10:98735641-98735663 CCATCTTTTGCATTGGCGTGACC 0: 1
1: 1
2: 7
3: 92
4: 555
Right 1072837824 10:98735657-98735679 CGTGACCTGGATGTGAGATATGG No data
1072837822_1072837828 14 Left 1072837822 10:98735641-98735663 CCATCTTTTGCATTGGCGTGACC 0: 1
1: 1
2: 7
3: 92
4: 555
Right 1072837828 10:98735678-98735700 GGAGTCAAAGGAGATCATTTGGG 0: 1250
1: 1855
2: 1529
3: 901
4: 676
1072837822_1072837826 2 Left 1072837822 10:98735641-98735663 CCATCTTTTGCATTGGCGTGACC 0: 1
1: 1
2: 7
3: 92
4: 555
Right 1072837826 10:98735666-98735688 GATGTGAGATATGGAGTCAAAGG 0: 75
1: 1403
2: 2020
3: 1537
4: 1059

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072837822 Original CRISPR GGTCACGCCAATGCAAAAGA TGG (reversed) Intronic
900822711 1:4901595-4901617 GGTCACACTAATGCAAGAGGTGG + Intergenic
901074921 1:6548074-6548096 GGCCACGCCAATGCAAATTTTGG - Intronic
902070653 1:13733108-13733130 GGACACGGCAATGTAAAACATGG - Intronic
907007714 1:50932500-50932522 GGTCACACGGATGCAAAAGGTGG + Intronic
907343962 1:53758930-53758952 GGTCACGTTGATGCAAAAGGTGG + Intergenic
907439314 1:54469075-54469097 GGTCACGCTGATGCAAGAGGTGG - Intergenic
908061921 1:60359729-60359751 GGAAATGCCACTGCAAAAGAAGG - Intergenic
908715807 1:67068131-67068153 GGTCACGCTGATGCAAGAGGTGG - Intergenic
908919326 1:69170606-69170628 GGTCACGCTAATGCAAGAAGTGG - Intergenic
908936456 1:69382913-69382935 GGTCACGCTGATGCAAAAGATGG + Intergenic
909068350 1:70963139-70963161 GGTCACGCCAATGCAAAAGGTGG + Intronic
909241629 1:73221397-73221419 GGTCACACTGATGCAAGAGATGG + Intergenic
909405337 1:75282153-75282175 GGTCACGCTAATGCAAGAGGTGG - Intronic
909510625 1:76448133-76448155 GGTCACGCTGATGCAAGAGGTGG - Intronic
909710793 1:78647147-78647169 GGTCACGCTGATGCAATAGGTGG + Intergenic
910256062 1:85248684-85248706 GGTCATGCTAATGCAAGAGGTGG + Intergenic
910468074 1:87522015-87522037 GATCACCCTAATACAAAAGATGG + Intergenic
910512832 1:88025490-88025512 GGTCACACTGATGCAAAAGGTGG + Intergenic
911267622 1:95761958-95761980 GGTCACGCTGAAGCAAAAGGGGG + Intergenic
911535042 1:99089777-99089799 GGTCACACTGATGCAAAAGGTGG - Intergenic
911541661 1:99164440-99164462 GGTCACACTGATGCAAGAGATGG - Intergenic
911788365 1:101979933-101979955 GGTCATGCTGATGCAAAAGATGG - Intronic
912117701 1:106427266-106427288 AGTCATGCCAATGCAAGAGGTGG - Intergenic
912907020 1:113718274-113718296 GGTCACGCTGATGCAAAAGGTGG + Intronic
913254139 1:116938992-116939014 GGTCACGCTAATGCAAGAGGTGG + Intronic
913459065 1:119064112-119064134 GGTCACGCTGATGCAAGAGGTGG - Intronic
914230592 1:145761924-145761946 GGTCATGCTGATGCAAAAGGTGG - Intronic
916814364 1:168337410-168337432 GGTCACACTGATGCAAAAGGCGG + Intergenic
917892511 1:179453439-179453461 GGTCATGCTGATGCAAGAGATGG - Intronic
918520792 1:185412802-185412824 GGACACGGAAATGCAAAACAAGG + Intergenic
918591341 1:186244954-186244976 GGTCACGTTGATGCAAGAGATGG + Intergenic
918734261 1:188038301-188038323 GGTCACGCCAATGCAAGAGGTGG - Intergenic
918935075 1:190911755-190911777 AGTCACGCTGATGCAAGAGATGG + Intergenic
918935551 1:190916256-190916278 GGTCACACAAATGCAAGAGGTGG - Intergenic
919209027 1:194455550-194455572 GATCATGCTTATGCAAAAGATGG + Intergenic
919371865 1:196738618-196738640 GGTCATGCTGATGCAAGAGATGG + Intronic
919376144 1:196796705-196796727 GGTCACGCTGATGCAGCAGATGG - Intergenic
919385848 1:196921598-196921620 GGTCACGCTGATGCAACAGGTGG - Intronic
920900667 1:210107133-210107155 GGTCATGCTGATGCAAGAGATGG + Intronic
921594282 1:217037957-217037979 GGTCATGCTGATGCAAAAGGGGG + Intronic
921773619 1:219071946-219071968 GGTCATGCTGATGCAAAAGGTGG - Intergenic
922320114 1:224479739-224479761 GGTCACACTGATGCAAGAGATGG + Intronic
922394071 1:225178055-225178077 GATCACGCTGATGCAAAAGGTGG - Intronic
922668840 1:227494082-227494104 GGTCACCACAATGCAAAAAAGGG + Intergenic
922670758 1:227507220-227507242 GGTCACCACAATGCAAAAAAGGG - Intergenic
923233135 1:232007404-232007426 GGTCATGCTGATGCAAGAGATGG - Intronic
924878127 1:248128354-248128376 AGTGAGGCCAATGCAGAAGATGG + Intergenic
1063809042 10:9682032-9682054 GGTCACACTGATGCAAGAGATGG - Intergenic
1065226139 10:23545508-23545530 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1065373379 10:25012505-25012527 GGTCACGCTGATGCAAGAGGTGG - Intronic
1066451928 10:35537563-35537585 GGTCACGCTGATCCAAAAGGTGG - Intronic
1067351603 10:45481035-45481057 GGTCATGCTAATGCAAGAGGTGG - Intronic
1067814768 10:49465158-49465180 GGTCACGCTGATGCAAGAGGTGG - Intronic
1068221989 10:54057014-54057036 GGTCATGCTGATGCTAAAGATGG + Intronic
1068805711 10:61192213-61192235 GGTCACGCTAATGCAACAGGTGG + Intergenic
1069094976 10:64248915-64248937 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1069424574 10:68278293-68278315 GGCCACGCTGATGCAACAGATGG - Intergenic
1070637700 10:78142355-78142377 GGTCACACCAATGCAAGAGGTGG - Intergenic
1071218704 10:83437232-83437254 CGTTATGCCAATGTAAAAGAAGG - Intergenic
1072039663 10:91594802-91594824 GTACACTCCAATGCAAGAGAGGG + Intergenic
1072837822 10:98735641-98735663 GGTCACGCCAATGCAAAAGATGG - Intronic
1072963470 10:99951552-99951574 GGTCACACCGATGCAAGAGGTGG - Intronic
1073360399 10:102893993-102894015 GGTCCCACCAAGGCACAAGATGG + Intronic
1073922059 10:108470637-108470659 GGTCATGCTAATGCCAAAGGTGG + Intergenic
1074622274 10:115138116-115138138 GGTCACGCTGATGCAAGAGGTGG + Intronic
1075281595 10:121143623-121143645 GGTCATGCTGATGCAAGAGATGG + Intergenic
1076585123 10:131541899-131541921 GGTCATGCTGATGCAAGAGATGG + Intergenic
1078482282 11:11687884-11687906 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1078687491 11:13546840-13546862 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1079559370 11:21803524-21803546 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1079586111 11:22128427-22128449 GGTCATGCTGATGCAAGAGATGG + Intergenic
1079644400 11:22844794-22844816 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1079652050 11:22942313-22942335 GGTCATGCTGATGCAAGAGATGG + Intergenic
1079886776 11:26000484-26000506 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1080449680 11:32368609-32368631 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1080477389 11:32608438-32608460 GGTCACGCTAATGCAAGAGGTGG + Intronic
1080843279 11:36004427-36004449 GGGCACACCGATGCAAAAGGTGG + Intronic
1080997317 11:37619465-37619487 GGCCATGCCAATACAAGAGATGG - Intergenic
1081008086 11:37773671-37773693 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1081033912 11:38117731-38117753 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1081108236 11:39099871-39099893 GGTCACACTGATGCAAAAGGTGG + Intergenic
1081175524 11:39922528-39922550 GGTCACACCAATGCAAGAGGTGG - Intergenic
1081769097 11:45636260-45636282 GGTCACACTGATGCAAAAGGTGG - Intergenic
1083496415 11:63058169-63058191 GATCACGCCAATGCAAGAGGTGG + Intergenic
1085593887 11:77790804-77790826 GGTCACGCTGATGCAAAAGATGG + Intronic
1086231785 11:84578441-84578463 GGTCACACTAATGCAAGAGATGG - Intronic
1086848613 11:91782735-91782757 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1086995672 11:93353289-93353311 GGTCATGCTGATGCAAAAGGTGG + Intronic
1087255494 11:95948349-95948371 GGTCATGCTGATGCAAGAGAGGG + Intergenic
1087264820 11:96048704-96048726 GGTCATGCCAATCTAAGAGAAGG - Intronic
1087908549 11:103726898-103726920 GGTCACTCTGATGCAAGAGATGG + Intergenic
1088426895 11:109714406-109714428 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1088850997 11:113703196-113703218 GGTCACGCTGATGCAAGAGGTGG - Intronic
1088869553 11:113879305-113879327 GGTCACACTGATGCAAAAGGTGG + Intergenic
1090991065 11:131817456-131817478 GGTCAGGCTGAAGCAAAAGATGG - Intronic
1091539753 12:1448981-1449003 GGTCACGCTGATGCAAGAGGTGG - Intronic
1093123328 12:15299597-15299619 GGTCATGCTGATGCAAAAGGTGG + Intronic
1093207126 12:16264207-16264229 GGTCATGCTAATGCAAGAGGTGG - Intronic
1094738377 12:33260412-33260434 GGTCACACTGATGCAAAAGGTGG - Intergenic
1094786831 12:33858898-33858920 GGTCACACTAATGCAAGAGGTGG + Intergenic
1095252792 12:39998455-39998477 GGTCATGCTGATGCAAAAGGTGG - Intronic
1095623280 12:44283419-44283441 GGTCACGCTGATGCAAGAGGTGG - Intronic
1095803390 12:46292745-46292767 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1096344610 12:50834517-50834539 GGTCACGCTGATGCAAGAGTTGG - Intergenic
1096410362 12:51372853-51372875 GGTCACGCTGATGCAAGAGGTGG - Intronic
1096904988 12:54927009-54927031 GGTCACGCTGATGCAATAGGTGG - Intergenic
1096960177 12:55569679-55569701 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1097142033 12:56909845-56909867 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1097400652 12:59124428-59124450 GGTCACACCGATGCAATAGGTGG + Intergenic
1097441279 12:59611863-59611885 GGTCATGCTGATGCAAAACATGG + Intronic
1097580751 12:61453857-61453879 GGTCACGTTGATGCAAGAGATGG - Intergenic
1097609979 12:61807704-61807726 GGTCACGCCGATGCAAGAGGTGG - Intronic
1098144899 12:67488239-67488261 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1098493794 12:71111983-71112005 GGTCATGCTGATGCAAAAGGTGG + Intronic
1098648721 12:72938982-72939004 GGTCACGCTAATGCAAGAGTTGG + Intergenic
1098713728 12:73801757-73801779 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1099004158 12:77216932-77216954 GGTCATGCTGATGCAAGAGATGG - Intergenic
1099379630 12:81938502-81938524 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1099769094 12:87029593-87029615 GGTCACATTAATGTAAAAGATGG + Intergenic
1099780140 12:87183500-87183522 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1099800632 12:87452118-87452140 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1101113321 12:101507151-101507173 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1101187103 12:102291237-102291259 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1101192981 12:102354187-102354209 GGTTACGCTGATGCAAGAGATGG + Intergenic
1101692823 12:107097213-107097235 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1102211658 12:111131766-111131788 GGTCATGTTGATGCAAAAGATGG + Intronic
1102248818 12:111371968-111371990 GGTCACGCTGATGCAAGAGATGG + Intergenic
1103588500 12:121973630-121973652 GGTCACGCTGATGCAAGAGGTGG - Intronic
1104807981 12:131601657-131601679 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1106942860 13:34796376-34796398 GGTCACGCCGATGCAAGAGGTGG - Intergenic
1107678165 13:42818429-42818451 GGTCACACTGATGCAAGAGATGG + Intergenic
1108140789 13:47419054-47419076 GGCCAGGTCAGTGCAAAAGAAGG - Intergenic
1108850924 13:54728200-54728222 GGTCACACTGATGCAAAAGGTGG - Intergenic
1109086042 13:57972831-57972853 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1109097958 13:58142205-58142227 GGTCACACTGATGCAAGAGATGG - Intergenic
1109098344 13:58145590-58145612 GGTCACGCTGATGCAAGAGATGG - Intergenic
1109346875 13:61125520-61125542 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1109393601 13:61725295-61725317 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1109480352 13:62944833-62944855 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1110250616 13:73376990-73377012 GGTCACACCAATGCAAGAGGTGG + Intergenic
1110359720 13:74611136-74611158 GGTCACACTGATGCAAGAGATGG - Intergenic
1110793108 13:79606929-79606951 GGTCACGCCGATGTAAGAGGTGG + Intergenic
1111065806 13:83089612-83089634 GGGCACACCGATGCAAGAGATGG - Intergenic
1111218758 13:85178363-85178385 GGTCACGCTGATGCAAGAGGAGG + Intergenic
1111566882 13:90028132-90028154 AGTCACACCAATGCAAGAGGTGG - Intergenic
1111751278 13:92334838-92334860 GGTCACACTGATGCAAAAGGTGG + Intronic
1112789473 13:102987525-102987547 GGTCACGCTGATGCAAGAGGGGG + Intergenic
1114871553 14:26665490-26665512 GGTCACGCTAATGCAAGAAGTGG + Intergenic
1114948465 14:27716295-27716317 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1114973692 14:28067097-28067119 GGTCATGCCAATGCAAGAAGTGG - Intergenic
1115085727 14:29512922-29512944 GGTCACGCTGATGCACAAGGTGG + Intergenic
1115134863 14:30096022-30096044 GGTCACGCTGATCCAAAAGGTGG - Intronic
1115541781 14:34427676-34427698 GGTCATGCTGATGCAAGAGATGG - Intronic
1115822278 14:37225058-37225080 GGTCACGCTGATGCAAGAGGTGG + Intronic
1115942288 14:38622615-38622637 GGTCACGCTGAGGCAAAAGGTGG - Intergenic
1115989951 14:39141287-39141309 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1116120587 14:40717818-40717840 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1116275307 14:42824759-42824781 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1116356338 14:43936349-43936371 GGTCACGCTAATGCAAGAGGTGG + Intergenic
1116378347 14:44232162-44232184 GGTCACGCTGATGCAAGAGATGG + Intergenic
1116528391 14:45935224-45935246 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1117198435 14:53363912-53363934 GGTCACGCTGATGCAAGAGATGG + Intergenic
1117854120 14:60009922-60009944 GGTCATGCTAATGCAAGAGGCGG + Intronic
1118627339 14:67671777-67671799 GGTCACCCCATGGCAGAAGATGG + Intronic
1119143031 14:72284865-72284887 GGTCACGCCGATGCAAGAGGTGG - Intronic
1119216265 14:72871573-72871595 GGTCACGCTGATGCAAGAGCTGG + Intronic
1120417893 14:84243237-84243259 GGTCACACTGATGCAAGAGATGG + Intergenic
1120443362 14:84564752-84564774 GGGCACGCTGATGCAAGAGATGG - Intergenic
1120485829 14:85112449-85112471 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1120688305 14:87563973-87563995 GGTCATGCCAATACAAGAGGTGG - Intergenic
1121166581 14:91807456-91807478 GGTCATGCTAATGCAAGAGGTGG - Intronic
1123138309 14:106050831-106050853 GGTCATGCTGATGCAACAGATGG - Intergenic
1123629030 15:22248038-22248060 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1124066341 15:26347428-26347450 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1124652866 15:31485859-31485881 GGTCACCCCAAAGCAAAGGTGGG + Intronic
1124695762 15:31863105-31863127 GGTCACGCTGATGCTAGAGATGG + Intronic
1126273010 15:46844520-46844542 GGGCACGCCAATGCAAGAGGTGG + Intergenic
1126366804 15:47903012-47903034 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1127720571 15:61694929-61694951 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1128177019 15:65565116-65565138 GGTCACGCTGATGCAAAAGGTGG + Intronic
1128814053 15:70592705-70592727 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1129900978 15:79149363-79149385 GGTCATGCTGATGCAAGAGATGG + Intergenic
1130421968 15:83756943-83756965 GGTCACGCTGATGCAAGAGGTGG + Intronic
1130439221 15:83934232-83934254 GGTCACACTGATGCAAGAGATGG - Intronic
1130804443 15:87304116-87304138 GGTCACACCACTGCAAAATTGGG + Intergenic
1131743593 15:95421053-95421075 GGTCATGCTGATGCAAGAGATGG + Intergenic
1131884851 15:96901335-96901357 GGTTACGCCAATTAAAAAAAGGG - Intergenic
1136059891 16:27719170-27719192 GGCCAGGCCAAGGCAGAAGAGGG + Intronic
1138198415 16:55071392-55071414 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1138355841 16:56379793-56379815 GGTCACGCTGATGCAAGAGACGG + Intronic
1139589304 16:67924606-67924628 GGTCCAGCCAAGACAAAAGAGGG - Intronic
1139812705 16:69636203-69636225 GGTCACGCTGATGCAAGAGGTGG + Intronic
1140146840 16:72319607-72319629 GGTCACACTGATGCAAAAGGTGG + Intergenic
1142840159 17:2622526-2622548 GGTCACGCTGATGCAAGAGGTGG + Intronic
1143260823 17:5596998-5597020 GGTCACTCCAAGGCAGCAGATGG + Intronic
1144399605 17:14883621-14883643 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1145022644 17:19443615-19443637 GGGAACACCAATGCAAAAGGTGG - Intergenic
1149116108 17:53098078-53098100 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1149204554 17:54228394-54228416 GGTCACACCGATGCAATAGGTGG - Intergenic
1150687452 17:67332022-67332044 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1151500917 17:74488374-74488396 GGTCACGCTGATGCAAGAGATGG + Intergenic
1154961969 18:21318271-21318293 GATCAGGCCACAGCAAAAGAAGG + Intronic
1155632066 18:27905849-27905871 GGTCACACTGATGCAAGAGATGG + Intergenic
1156151533 18:34249570-34249592 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1156651175 18:39228473-39228495 AGTCACGCTGATGCAAAAGGTGG - Intergenic
1156711981 18:39958078-39958100 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1156784467 18:40893376-40893398 GGTCACTCTGATGCAAAAGGTGG - Intergenic
1156809131 18:41225322-41225344 GGTCATGCCAATGCAAGAGGTGG - Intergenic
1157003031 18:43550056-43550078 GGTCACGCAAATGCAAGAGGTGG + Intergenic
1157941173 18:51930403-51930425 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1158335874 18:56414606-56414628 GGTCACACTGATGCAAGAGATGG - Intergenic
1158448961 18:57546598-57546620 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1159508083 18:69361148-69361170 GGTCACGCTGTTGCAAGAGATGG - Intergenic
1159640706 18:70859896-70859918 GGTCATGCCAATGCAAAAGGTGG - Intergenic
1159643273 18:70888154-70888176 GGTCATGCCAATGCAAGAGGTGG - Intergenic
1160599469 18:80001596-80001618 GGTCACACTGATGCAAAAGGTGG - Intronic
1160602254 18:80022704-80022726 GGTCACGCCAAAGCAAGGAAGGG - Intronic
1164210163 19:23091572-23091594 GGTCACGCTGATGCAAAAGGTGG - Intronic
1164494746 19:28749760-28749782 GTTCACGCTGATGCAAAAGGTGG + Intergenic
1166652398 19:44584380-44584402 GGTAATGCTAATGGAAAAGAAGG + Intergenic
1167403545 19:49288965-49288987 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1167492397 19:49800250-49800272 GGTCACGGCAGTGCAGGAGAAGG - Intronic
1168342605 19:55634217-55634239 GGTAACGCCAAGGCCATAGAGGG - Intergenic
925443477 2:3908131-3908153 GGTCATGCCGATGCAAGAGATGG + Intergenic
925638389 2:5964675-5964697 GGTCACGCTGATGCAAGAGGTGG + Intergenic
926448449 2:12973158-12973180 GGTCATGCTGATGCAAAAGATGG + Intergenic
926456467 2:13073745-13073767 GGTCACACTAATGCAAGAGGTGG + Intergenic
926929545 2:18023449-18023471 GGTCATGCTGATGCAAAAGATGG + Intronic
927100376 2:19783450-19783472 GGTCACGCTGATGCAAAAGGTGG - Intergenic
927400689 2:22706999-22707021 GGTCACGCTGATGCAAAAGGTGG + Intergenic
928066183 2:28166630-28166652 AGTCACGCCAGTGCAAAGAAGGG - Intronic
928379408 2:30804709-30804731 GTCCACGGCCATGCAAAAGATGG - Intronic
928594346 2:32845914-32845936 GGTCATGCCAATGCAAGAGGTGG - Intergenic
928731529 2:34237944-34237966 GGTCAGGCTAATGCAACAGATGG - Intergenic
930230188 2:48835363-48835385 GGTCATGCTGATGCAAAAGGTGG - Intergenic
930560036 2:52949710-52949732 GGTCATGCTGATGCAAAAGGTGG + Intergenic
930960080 2:57251137-57251159 GGTCATGCCAATGCAAGAAGTGG + Intergenic
931096179 2:58943283-58943305 GGTCATGCTGATGCAAAAGTGGG - Intergenic
931176659 2:59861349-59861371 GGTAATGCCAATGCAAGAGGTGG + Intergenic
931494048 2:62783157-62783179 GGTCACGCTGATGCAAGAGGTGG + Intronic
932849598 2:75171666-75171688 GGTCACGCTGATGCAAGAGGAGG - Intronic
932976118 2:76602088-76602110 GGTCACGCTGATGCAAGAGGTGG + Intergenic
933047654 2:77558602-77558624 GGTCACGCTGATGCAAGAGGTGG - Intronic
933070960 2:77857475-77857497 GGGCAAGCTAATGCAAGAGATGG - Intergenic
936683823 2:114804537-114804559 GGTCACGCTGATGCAAGAGGTGG - Intronic
936915783 2:117637863-117637885 GGTCACGCTGATGCAAAAGGTGG - Intergenic
937427719 2:121813830-121813852 GGTCACGCTTATGCAAAAGGTGG - Intergenic
937761123 2:125604455-125604477 GGTTACACTGATGCAAAAGATGG - Intergenic
937881210 2:126866227-126866249 GGTCACTCTGATGCAAAAGGTGG + Intergenic
938165441 2:129021655-129021677 GGTCACGCTGATGCAAGAGGTGG - Intergenic
939225081 2:139354216-139354238 GGTCACGCTCATGCAAGATATGG - Intergenic
939348406 2:140999362-140999384 GGTAACCCCAATGCAATAAAAGG - Intronic
939830478 2:147064752-147064774 GGTCATGCTGATGCAAAAGATGG - Intergenic
940143807 2:150523978-150524000 GGTCAAGCTGATGCAAGAGATGG - Intronic
940430820 2:153588062-153588084 GGTCATGCTGATGCAAAAGATGG + Intergenic
940505403 2:154547014-154547036 GGTCACGCTGATGAAAGAGATGG - Intergenic
941649881 2:168081295-168081317 GGTTACGCTGATGCAAGAGATGG - Intronic
941755428 2:169180562-169180584 GGACATGCCACTGAAAAAGAAGG - Intronic
941803531 2:169687569-169687591 GGTCATGCTGATGCAAAAGGTGG + Intronic
942054347 2:172168389-172168411 GGTCACGCTGATGCAAGAGGTGG - Intergenic
942204384 2:173604866-173604888 GGTCATCCCTATGCAAGAGAGGG - Intergenic
942420031 2:175797755-175797777 GGTCATGCTGATGCAAAAGGTGG - Intergenic
942644434 2:178095400-178095422 GGTCACGCTGATGCAAGAGGTGG + Intronic
942727583 2:179026803-179026825 GGTCATGCTGATGCAAAAGGTGG - Intronic
943072127 2:183153597-183153619 GGTCACGCTGATGCAAGAGGTGG + Intronic
943313291 2:186353813-186353835 GGTCACACTGATGCAAAAGATGG - Intergenic
943386763 2:187210966-187210988 GGTCATGCTGATGCAAAAGGTGG - Intergenic
943406323 2:187492601-187492623 GGTCACGCTGATGCAAGAGGTGG - Intronic
943427307 2:187752487-187752509 GGTCACACTAATGCAAAGGTGGG + Intergenic
943471549 2:188300610-188300632 GGTCAAGCCAAGCAAAAAGAAGG - Intronic
943565405 2:189510256-189510278 GGTCACGCTGATGCAAGAGGTGG - Intergenic
943788232 2:191901834-191901856 GGTCACACTAATGCAACAGATGG - Intergenic
943998132 2:194797472-194797494 GGTCACGCTGATGCAAAAGGTGG - Intergenic
944250273 2:197574284-197574306 GGTCACACTGATGCAAGAGATGG - Intronic
944827931 2:203503951-203503973 GGTCACGCTGATGCAAAAGGTGG + Intronic
945618759 2:212107261-212107283 GGTCACGCTGATGCAAGAGGTGG - Intronic
945709554 2:213278510-213278532 GGTCAAGCTGATGCAAGAGATGG - Intergenic
946515330 2:220405230-220405252 GGTCACACTGATGCAAGAGATGG + Intergenic
946844958 2:223850853-223850875 GGTCACGCTGATGCAAGAGGTGG - Intergenic
946988677 2:225303148-225303170 GGTCATGCTGATGCAAAAGGTGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948520248 2:238531955-238531977 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1169336554 20:4761388-4761410 GCTCACGTAAATGCAAAAGATGG + Intergenic
1169676279 20:8158845-8158867 GGTCACACTGATGCAAGAGATGG + Intronic
1169985150 20:11435749-11435771 GGTCACGCTAATGCAAGAGATGG + Intergenic
1171130051 20:22644211-22644233 GGTCACACTGATGCAAAAGGTGG + Intergenic
1171873303 20:30547743-30547765 GGTCACGCTGATGTAAGAGATGG + Intergenic
1172720312 20:36994936-36994958 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1172811933 20:37654404-37654426 GGTCACACTGATGCAAGAGATGG + Intergenic
1176657645 21:9602260-9602282 GGTCATGCTGATGCAAGAGATGG + Intergenic
1176688414 21:9875534-9875556 GGTCACACAGATGCAAGAGATGG + Intergenic
1176688980 21:9881501-9881523 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1176696055 21:9978881-9978903 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1177026267 21:15925259-15925281 GGTCACGCTGATGCAAGAGATGG + Intergenic
1177236133 21:18391935-18391957 GGTCAGGCCATTGCTTAAGAGGG - Intronic
1177244981 21:18511092-18511114 GGGCACGCTGATGCAAGAGACGG - Intergenic
1177317391 21:19479066-19479088 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1177339707 21:19783555-19783577 GGTCACGCTGATGCAAGAGGAGG + Intergenic
1177477703 21:21645161-21645183 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1177485097 21:21746392-21746414 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1177654823 21:24003845-24003867 GGTCACGCTGATGTAAGAGATGG + Intergenic
1178634156 21:34287945-34287967 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1178691074 21:34750552-34750574 AATCACCCCAATACAAAAGAAGG - Intergenic
1179065195 21:38018156-38018178 GGTCATGCTGATGCAAAAGGTGG - Intronic
1182330104 22:29545672-29545694 GGTCAAGCTGATGCAAAAGGTGG + Intronic
1182505142 22:30776858-30776880 GGTCACGCTGATGCAAGAGGTGG - Intronic
1184928227 22:47659369-47659391 GGTCACGCTGATGCAAGAGGTGG + Intergenic
949770292 3:7570535-7570557 GGTCATGCTGATGCAAAAGGTGG + Intronic
951093019 3:18597644-18597666 GGTCACGCCGATGCAAGAGGTGG + Intergenic
951324630 3:21286903-21286925 GGTCACGCTGATGCAATAGGTGG - Intergenic
951756395 3:26096084-26096106 GGTCACGCTGATGCAAGAGGTGG + Intergenic
951936154 3:28025080-28025102 GGTCACGCCGATGCAAGAAGTGG - Intergenic
951969733 3:28430232-28430254 GGTCACGCTGATGCAAGAGGTGG - Intronic
952170207 3:30798951-30798973 GGTCACGCTGATGCAAGAGGTGG + Intronic
952504465 3:33995509-33995531 GGTCACACTAATGCAAGAGGTGG + Intergenic
952739775 3:36724067-36724089 GGTCACGCTAATGCAAGAGGTGG - Intronic
956246216 3:67186320-67186342 GGTCACGCTCATGCAAGAGGTGG + Intergenic
956503323 3:69910600-69910622 GGTCATGCTGATGCAAAAGGTGG - Intronic
957105581 3:75883315-75883337 GGTCATGCCAATGCAAGAGGTGG + Intergenic
957909562 3:86604032-86604054 GGTCACGCTGATGCAAGAGGTGG - Intergenic
958146590 3:89631966-89631988 GGTCATGCTGATGCAAAAGGTGG - Intergenic
958160785 3:89815041-89815063 GGTCACACTGATGCAAAAGATGG + Intergenic
958956409 3:100469636-100469658 GGTCACGCTGATGCAAGAGGAGG + Intergenic
959141084 3:102487290-102487312 GGTCACACCAATGCAAGAGGTGG - Intergenic
959695617 3:109246202-109246224 GGTCACGCTAATGCAAGAGGTGG + Intergenic
959754660 3:109883414-109883436 GGTCACGCTGATGCAAGAGATGG + Intergenic
959803631 3:110525263-110525285 GGTCATGCTGATGCAAGAGATGG - Intergenic
959851877 3:111097136-111097158 GGTCACGCTGATACAACAGATGG - Intronic
959968467 3:112381902-112381924 GGTCACGCTGATGAAAAAGGTGG - Intergenic
960362931 3:116735731-116735753 GGTCACACTGATGCAAGAGATGG - Intronic
960564344 3:119117951-119117973 GGTCACACTGATGCAAAAGGTGG + Intronic
960843007 3:121979028-121979050 GGTCACACTGATGCAAGAGATGG - Intergenic
962170730 3:133098770-133098792 GGTCTCGCTGATGCAAAAGGTGG + Intronic
962339438 3:134569533-134569555 GGTCACGCTGATGCAAAAGGTGG + Intronic
963072767 3:141318692-141318714 GGTCACGCTGATGCAAGAGGTGG + Intergenic
963339708 3:144019803-144019825 GGTCATGCCGATGCAAAAGGTGG + Intronic
963716752 3:148812031-148812053 GGTCACACTAATGCAAGAGGTGG - Intronic
964090789 3:152873754-152873776 GGTCACGCTGATGCAAGAGGTGG + Intergenic
964426789 3:156562152-156562174 GGTCACGCTGATGCAAGAGGTGG - Intergenic
964427466 3:156568633-156568655 GGTCACGCTGATGCAAGAGGTGG - Intergenic
964520623 3:157563113-157563135 GGTCACACTGATGCAAAAGGTGG + Intronic
964836231 3:160940995-160941017 GGTCACGCTGATGCAAGAGGTGG - Intronic
965092529 3:164181353-164181375 GGTCACGCTGATGCAAGAGGTGG + Intergenic
965915619 3:173842666-173842688 GGTCACGCTGATGCAAGAGGTGG + Intronic
965929833 3:174029289-174029311 GGTCACACTGATGCAAGAGATGG - Intronic
966074341 3:175919027-175919049 GGTCATGCTGATACAAAAGATGG + Intergenic
966466197 3:180233519-180233541 GGTCACGCTGATGCAAGAGGTGG + Intergenic
966576775 3:181511247-181511269 GGTCACGCTGATGCAAGAGGTGG - Intergenic
967501647 3:190204390-190204412 GGTCACGCTGATGCAAGAGACGG - Intergenic
969072648 4:4551821-4551843 GGTCACACCAATGCAAGAGGTGG - Intergenic
969121866 4:4916786-4916808 GGTCATGCTGATGCAAAAGGTGG + Intergenic
969871802 4:10109343-10109365 GGTCACGTCACTGCAAATCAGGG + Intronic
970462083 4:16284592-16284614 GGTCATGCTGATGTAAAAGATGG - Intergenic
970655969 4:18230227-18230249 GGTCACGCTGATGCAAGAGGTGG - Intergenic
970750382 4:19352767-19352789 GGTCACACTAATGCAAGAGGTGG + Intergenic
970788550 4:19828984-19829006 GGTCACACTGATGCAAAAGGTGG - Intergenic
970801270 4:19976143-19976165 GGTCATGCTGATGCAAGAGATGG + Intergenic
971111650 4:23592182-23592204 GGTCATGCTGATGCAAAAGGTGG - Intergenic
971519696 4:27533145-27533167 GGTCACAGCCAAGCAAAAGAAGG - Intergenic
971948739 4:33315712-33315734 GGTCACACTAATGCAAGAGGTGG - Intergenic
971977498 4:33709953-33709975 GGTCACGCTGATGTAAAAGGTGG + Intergenic
972056136 4:34805814-34805836 GGTCACGCTGATGCAAGAGGTGG + Intergenic
972087880 4:35242236-35242258 GGTCATGCTGATGCAAAAGGAGG - Intergenic
972105114 4:35475267-35475289 GTGCAAGCCAAAGCAAAAGAGGG - Intergenic
972582497 4:40407081-40407103 GGTCACACTGATGCAAAAGGTGG - Intergenic
972756886 4:42057009-42057031 GGTCACGCTGATGCAAAAGGTGG + Intronic
972963680 4:44484867-44484889 GGTCAAGCCAAGGTAAAAGCAGG + Intergenic
973094550 4:46180103-46180125 GGTCATGCTGATGCAAAAGATGG - Intergenic
973718367 4:53700071-53700093 GGTCATGCTAATTCAAAAGGTGG + Intronic
974071498 4:57128068-57128090 GGTCACACCAATGAAAAAGGTGG - Intergenic
974125737 4:57693362-57693384 GGTCACACTGATGCAAAAGGTGG - Intergenic
974480624 4:62438256-62438278 GGTCACGCTGATGCAAATGGTGG + Intergenic
974872557 4:67660886-67660908 GGTCACGCTGATGCAAGAGGTGG - Intronic
974897661 4:67958383-67958405 GGTCACACTGATGCAAAAGGTGG - Intronic
975456551 4:74597635-74597657 GGTCACGCTAATGCAAGAGGTGG - Intergenic
975632475 4:76417099-76417121 GGTCACGCTGATGCGAGAGATGG - Intronic
975878193 4:78868802-78868824 GGTCATGCTGATGCAAAAGGTGG + Intronic
976277227 4:83289999-83290021 GGTCACACTGATGCAAAAGGTGG - Intergenic
976312227 4:83623481-83623503 GGTCATGCTGATGCAAGAGATGG - Intergenic
976678188 4:87726017-87726039 GGTCATGCTGATGCAAGAGATGG - Intergenic
977015916 4:91693335-91693357 GGTCATGCTGATGCAAGAGATGG + Intergenic
977097882 4:92769263-92769285 GGTCATGCTGATGCAAAAAATGG + Intronic
977365912 4:96068062-96068084 GGTCACACTAATGCAAAAGGTGG + Intergenic
977463606 4:97356652-97356674 GGTTATGCCAATGCAAGAGGTGG + Intronic
977952772 4:102993410-102993432 GGTCACGCTGATGCAAGAGGTGG + Intronic
977973121 4:103233500-103233522 GGTCATGCTGATGCAAGAGATGG - Intergenic
978153493 4:105464176-105464198 GGTCACGCCGATGCAAGAGGTGG - Intronic
978213104 4:106162245-106162267 GGTCATGCTGATGCAAGAGATGG + Intronic
978654830 4:111052538-111052560 GGTCACGCTGATGCAAGAGGTGG - Intergenic
979063607 4:116098729-116098751 GGTCACGCTAATGCAAGAGGTGG - Intergenic
979390053 4:120117634-120117656 GGTCACTCTAATGCAAGAGGTGG + Intergenic
979405859 4:120310104-120310126 GGTCATGCTGATGCAAGAGATGG + Intergenic
979495688 4:121380342-121380364 GGTGACGGGAATGCAGAAGAAGG + Exonic
979645204 4:123060077-123060099 GGTCACACTGATGCAAGAGAGGG + Intronic
979922948 4:126524389-126524411 GGTCACGCTGATGCAAGAGGTGG + Intergenic
980310664 4:131125728-131125750 GGTCATGCTGATGCAAGAGATGG + Intergenic
980335619 4:131469324-131469346 GGTCACGCTAATGCAAGAGGTGG - Intergenic
980351790 4:131693333-131693355 GGTCACACTGATGCAAGAGATGG + Intergenic
980352365 4:131699319-131699341 GGTCATGCTAATGCAAGAGGTGG + Intergenic
980523121 4:133957370-133957392 GGTCATGCTGATGCAAGAGATGG + Intergenic
980646175 4:135644581-135644603 GGTCATGCTGATGCAAGAGATGG - Intergenic
980846687 4:138333034-138333056 GGTCACACTAATGCAAGAGGTGG + Intergenic
981242455 4:142493497-142493519 GGTCACACTGATGCAAGAGATGG - Intronic
982279206 4:153666434-153666456 GGTCACGCTGATGCAAGAGGTGG - Intergenic
982829488 4:160042883-160042905 GGTCACGCTGATGCAAGAGATGG + Intergenic
982832881 4:160086050-160086072 GGTCACACTGATGCAAAGGATGG + Intergenic
982868138 4:160543725-160543747 GGTCATGCTGATGCAAGAGATGG + Intergenic
983340561 4:166455142-166455164 GGTCACGCTGATGCAAGAGGTGG - Intergenic
983431725 4:167659539-167659561 GGTCACGCTGATGCAAGAGGTGG + Intergenic
983669139 4:170215620-170215642 GGTCACACTGATGCAACAGATGG - Intergenic
983723776 4:170893194-170893216 GGTCATGCTGATGCAAAAGGTGG + Intergenic
983874824 4:172863427-172863449 GGTCACACTGATGCAAGAGATGG - Intronic
983968591 4:173844067-173844089 GGTCACGCTAATGCAAGACCTGG - Intergenic
984318505 4:178160942-178160964 GGTCACGCTGATGCAAGAGGTGG + Intergenic
984774335 4:183467479-183467501 GGTCACGCTGATGCAAGAGATGG - Intergenic
985417761 4:189753825-189753847 GGTCATGCTGATGCAAGAGATGG - Intergenic
985431760 4:189888048-189888070 GGTCACGCCGAAGCAAGAGTTGG + Intergenic
986258651 5:6123577-6123599 GGTCATGCTGATGCAAAAGGTGG + Intergenic
986680025 5:10224256-10224278 GGTCACACTGATGCAAAAGGTGG + Intergenic
986798167 5:11232421-11232443 GGTCACGCTGATGCAAGAGATGG - Intronic
987134760 5:14890274-14890296 GGTAACGGGAATGAAAAAGAAGG + Intergenic
987252336 5:16112352-16112374 GGTCACGCTGATGCAAGAGGTGG - Intronic
987457501 5:18165333-18165355 GGTCATGCTGATGCAAGAGATGG + Intergenic
987602028 5:20084319-20084341 GGTCATGCTGATGCAAGAGATGG + Intronic
988052910 5:26054272-26054294 GGTCACACTCATGCAAAAGGTGG + Intergenic
988070696 5:26284898-26284920 GGTCATGCTGATGCAAAAGCTGG + Intergenic
988129053 5:27079560-27079582 GGTCATGCTGATGCAAAAGATGG + Intronic
988204321 5:28115027-28115049 GGTCATGCTGATGCAAAAGGTGG + Intergenic
988426785 5:31073963-31073985 GGTCAGGCTGATGCAAGAGATGG + Intergenic
988471860 5:31547214-31547236 GGTCACGCTGATGCAAGAGGTGG + Intronic
988740050 5:34061202-34061224 GGTCATGCTGATGCAAGAGATGG + Intronic
989203333 5:38787150-38787172 GGTCACGCTGATGCAAGAGGTGG - Intergenic
989501823 5:42177133-42177155 GGTCATGCTGATGCAAGAGATGG + Intergenic
989516404 5:42348507-42348529 GGTCACACCAATGCAAGTGGTGG - Intergenic
989673355 5:43946041-43946063 GGTCACGCTGATGCAAGAGGTGG + Intergenic
989726787 5:44597019-44597041 GGTCACACTGATGCAAAAGGTGG + Intergenic
989753474 5:44923036-44923058 GGTCATGCTGATGCAAAAGGTGG - Intergenic
990093345 5:52082871-52082893 GGTCACGCTGATGCAAGAGGTGG + Intergenic
991039247 5:62159113-62159135 GGTCACGCTGATGCAAGAGATGG - Intergenic
992651481 5:78864909-78864931 GGTCACGCTGATGCAAGAGGTGG + Intronic
993200864 5:84813240-84813262 GGTCACGCTGATGCAAGAGGTGG - Intergenic
993260791 5:85655644-85655666 GGTCACACTGATGCAAAAGGTGG - Intergenic
993517589 5:88857116-88857138 GGTCATGCTGATGCAAAAGGTGG - Intronic
993761242 5:91799944-91799966 GGTCATGCTAATGCAAGAGGTGG + Intergenic
994338846 5:98601306-98601328 GGTCACACTAATGCAAGAGGTGG - Intergenic
994524268 5:100883197-100883219 GGTCACGCTGATGCAAGAGGTGG - Intronic
994755568 5:103790099-103790121 GGTCACGCTGATGCAAGAGGTGG + Intergenic
995011326 5:107259914-107259936 GGTCACACCGATGCAAGAGGTGG + Intergenic
995147840 5:108806591-108806613 GGTCACGCAGATGCAAGAGGCGG - Intronic
995333770 5:110975938-110975960 GGTCACGCTGATGCAAGAGGTGG + Intergenic
995391043 5:111640388-111640410 GGTCACACTAATGCAAGAGGTGG - Intergenic
995630465 5:114126995-114127017 GGTCGCGCTGATGCAAGAGATGG + Intergenic
996030859 5:118702872-118702894 GGTCACGCTGATGCAAGAGGTGG + Intergenic
996196410 5:120611995-120612017 GGTCACGCTGATGCAAGAGGTGG - Intronic
996243172 5:121227233-121227255 GGTCACACTGATGCAAAAGGTGG - Intergenic
996617464 5:125458350-125458372 GGTCACGCTGATGCAAAATGTGG - Intergenic
996670665 5:126113577-126113599 GGTCATGCTGATGCAAGAGATGG - Intergenic
996967237 5:129320853-129320875 GATCACACCAATGCAAGAGATGG + Intergenic
997057408 5:130460564-130460586 GGTCACACCGATGCAAGAGGTGG - Intergenic
997181359 5:131832348-131832370 GGTCACACTGATGCAAAAGGTGG + Intronic
997491815 5:134284005-134284027 GGTCACACTAATGCAAGAGGTGG + Intergenic
997692941 5:135839288-135839310 GGTCACACTAATGCAAGAGGTGG - Intronic
998576599 5:143323947-143323969 GGTCATGCTGATGCAAAAGATGG + Intronic
998980612 5:147698096-147698118 GGTCACACTAATGCAAGAGGTGG - Intronic
999020778 5:148163481-148163503 GGCCACACCAATGCAAGGGATGG + Intergenic
999346030 5:150820378-150820400 GGTTACGCTGATGCAAGAGATGG + Intergenic
1000142491 5:158419114-158419136 TCTCAAGCCAATGCAAAAAAAGG + Intergenic
1000526791 5:162368751-162368773 GGTCATGCTGATGCGAAAGATGG + Intergenic
1000768268 5:165318797-165318819 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1002432398 5:179211119-179211141 GGTCCCTCCAAGGCAGAAGAGGG + Intronic
1002958169 6:1888946-1888968 GGTCACACTAATGCAAGAGGTGG + Intronic
1004592864 6:17070345-17070367 GGTCACGCTGATACAAGAGATGG - Intergenic
1006024830 6:31140080-31140102 GATCACGCCATTGCATAATAAGG - Exonic
1006476792 6:34260777-34260799 GGTCACGCTGATGCAAGATAGGG + Intergenic
1007296563 6:40826741-40826763 TGTTCAGCCAATGCAAAAGAAGG - Intergenic
1009289430 6:61865893-61865915 GGTCACGCTGATGCAAGAGGTGG + Intronic
1009396195 6:63203447-63203469 GGTCACACTGATGCAAAAGGTGG + Intergenic
1009396680 6:63207207-63207229 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1010630133 6:78189364-78189386 GGTCAAGCTGATGCAAGAGATGG + Intergenic
1010631755 6:78207202-78207224 GGTCACGCTAATACAACAGGTGG + Intergenic
1010810352 6:80292947-80292969 GGTCAGGCTAATGCAAGAGGTGG + Intronic
1011122141 6:83965329-83965351 GGTCACGCTGATGCAAGAGGTGG - Exonic
1011346066 6:86370686-86370708 TGTCACGCTGATGCAAGAGATGG + Intergenic
1011821276 6:91256176-91256198 GGTCACACTGATGCAAGAGATGG - Intergenic
1011870523 6:91886642-91886664 GGTCACATCAATGCAAGAGATGG - Intergenic
1012690699 6:102307829-102307851 GGTCATGCTGATGCAAGAGATGG + Intergenic
1012700463 6:102451034-102451056 GGTCAAGCTGATGCAAAAGGTGG + Intergenic
1012967205 6:105687516-105687538 GGTCACACTGATGCAAGAGATGG - Intergenic
1013149120 6:107426685-107426707 GGTCACGCTGATGCAAAGGGTGG - Intronic
1014576606 6:123081841-123081863 GTTCACACTGATGCAAAAGATGG + Intergenic
1014621626 6:123674619-123674641 GGTCACGATGATGCAAAAGGTGG + Intergenic
1014714625 6:124849500-124849522 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1014730896 6:125030633-125030655 GGTCACGCTGATGCAAGAGGTGG + Intronic
1015487616 6:133790209-133790231 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1015693268 6:135950751-135950773 GGACTCGCCAATGGAAGAGAAGG - Intronic
1015995837 6:138994532-138994554 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1016106537 6:140170913-140170935 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1016121456 6:140347165-140347187 GGTCAGACCAATAAAAAAGATGG - Intergenic
1016202507 6:141429950-141429972 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1016264265 6:142213300-142213322 GGTCATGCCAATGCAAGGGGTGG + Intronic
1016579783 6:145616690-145616712 GGTCACGCTGATGCAAGAGGTGG - Intronic
1016595186 6:145790621-145790643 GGTCATGCCAATGCAAGAAGTGG + Intergenic
1016611891 6:145999456-145999478 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG + Intronic
1018516046 6:164581232-164581254 GGTCACACCGATGCAAGAGGTGG + Intergenic
1018558572 6:165075683-165075705 GGTCACGCTAATGAATAAGGAGG + Intergenic
1018922638 6:168186126-168186148 GGTCACACTAATGCAAGAGGTGG + Intergenic
1019872576 7:3779340-3779362 GGTAGCTACAATGCAAAAGACGG - Intronic
1020837155 7:13168069-13168091 GGTCACACTGATGCAAGAGATGG + Intergenic
1021529756 7:21631664-21631686 GGTCACGCTGATGCAAGAGGTGG + Intronic
1022595918 7:31713344-31713366 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1022607907 7:31834490-31834512 GGTCATGCTGATGCAAGAGATGG - Intronic
1022862580 7:34383254-34383276 GGTCACACTGATGCAAGAGATGG - Intergenic
1022964228 7:35457791-35457813 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1023386308 7:39661603-39661625 GGTCACTCTGATGCAAAAGGTGG + Intronic
1024021371 7:45373834-45373856 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1024413716 7:49078626-49078648 GGTCACGCTGATTCAAAGGATGG + Intergenic
1024424694 7:49212282-49212304 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG + Intronic
1026278736 7:68903114-68903136 GGTCATGCAAATGCAAGAGGTGG - Intergenic
1026700053 7:72633172-72633194 GGGCAGGCCAATGCAAATAAAGG - Intronic
1027369641 7:77494544-77494566 GGTCATGCTAATGCAAGACATGG - Intergenic
1027958976 7:84919531-84919553 GGTCACACTAATGCAAAAGGTGG + Intergenic
1028041989 7:86064209-86064231 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1028066500 7:86391489-86391511 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1028624461 7:92862733-92862755 GGTCATGCCGATGCAAGAGGTGG + Intergenic
1028960981 7:96749691-96749713 GATCATGCTGATGCAAAAGATGG + Intergenic
1030108429 7:106006636-106006658 GGTCACGCTCATGCAAGAGGTGG + Intronic
1030390632 7:108923317-108923339 GGTCTCTCCAATGCAGAAAATGG + Intergenic
1030908957 7:115223029-115223051 GGTCAAGTCAATGGAAAGGATGG + Intergenic
1031011282 7:116526754-116526776 GTACACGGCAATGCTAAAGAAGG - Intronic
1031175111 7:118339513-118339535 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1031288881 7:119907771-119907793 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1031290582 7:119928876-119928898 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1032318337 7:130861548-130861570 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1033720989 7:144059458-144059480 GGTCACGCTCATGCAAGAGATGG + Intergenic
1033730301 7:144171629-144171651 GGTCATGCTGATGCAAGAGATGG - Intergenic
1033833131 7:145276852-145276874 GGTCACACTGATGCAAGAGATGG - Intergenic
1034320172 7:150172915-150172937 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1034510632 7:151531919-151531941 GGTCACGCTGATGCAAGAGATGG + Intergenic
1034772576 7:153794306-153794328 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1035149843 7:156860852-156860874 GGTCACACTGATGCAAAAGGTGG + Intronic
1035834087 8:2729277-2729299 GGTCCAGCCAAAGCAAAAGTGGG - Intergenic
1036457639 8:8923961-8923983 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1037117892 8:15247662-15247684 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1039309295 8:36298077-36298099 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1040397138 8:47010874-47010896 GGTCACGCTGATGCAAGAGATGG + Intergenic
1041075047 8:54161514-54161536 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1041823814 8:62068690-62068712 GGTCATGCTGATGCAAGAGATGG - Intergenic
1041965186 8:63667837-63667859 GGTCACACTAATGCAAGAGGTGG - Intergenic
1042761573 8:72276822-72276844 GGTCACACTGATGCAAAAGTTGG - Intergenic
1043119721 8:76308159-76308181 GCTCACACCAATGCAGAAGACGG + Intergenic
1043426173 8:80150603-80150625 GGTCACGCTGATGCAAGAGGTGG - Intronic
1044256131 8:90064511-90064533 TGTCAGGCCAATCCAACAGAGGG + Intronic
1044279788 8:90341387-90341409 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1044887383 8:96793920-96793942 GGTCATGCCAATGCAAAATGTGG + Intronic
1045050429 8:98319647-98319669 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1045617822 8:103938910-103938932 GGTCACGCTGATGCAAGAGGTGG + Intronic
1045888472 8:107127035-107127057 GGTCACGCTGATGCAAAAAGTGG + Intergenic
1046226284 8:111285156-111285178 GGTCACGCTGATGCAAGAGGCGG + Intergenic
1046814834 8:118572078-118572100 GGTCACGCTGATGCAAGAGGTGG - Intronic
1046880141 8:119298855-119298877 GTTCATGCTAATGCAAAGGATGG + Intergenic
1047870008 8:129071882-129071904 GGTCATGCTGATGCAAGAGATGG - Intergenic
1047969742 8:130074587-130074609 GGAAACAGCAATGCAAAAGATGG + Intronic
1048419396 8:134262009-134262031 GGTCACGCTGATGCAAAAGGTGG - Intergenic
1048675075 8:136769601-136769623 TGTCACGCTGATGCAAAAGGTGG + Intergenic
1048706066 8:137154920-137154942 GGTCACTCCGATGCAAGAGGTGG - Intergenic
1048783037 8:138022247-138022269 GGTCATGCTAATGCAAAAGGTGG - Intergenic
1050402523 9:5271187-5271209 GGTCACGCTAATGCAAGAGGTGG - Intergenic
1050832333 9:10029483-10029505 GGTCATGCTGATGGAAAAGATGG - Intronic
1051743826 9:20276396-20276418 GGTCACGCTGATGCAAGAGTTGG + Intergenic
1052210119 9:25893850-25893872 GGTCACACTGATGCAAGAGATGG + Intergenic
1052614583 9:30821600-30821622 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1053780347 9:41600394-41600416 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1053780929 9:41606368-41606390 GGTCACACAGATGCAAGAGATGG - Intergenic
1054168289 9:61810551-61810573 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1054168872 9:61816525-61816547 GGTCACACAGATGCAAGAGATGG - Intergenic
1054668659 9:67764286-67764308 GGTCACACAGATGCAAGAGATGG + Intergenic
1054669240 9:67770267-67770289 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1055122787 9:72682042-72682064 GGACTCACCAATCCAAAAGAGGG - Intronic
1055231974 9:74077242-74077264 GGTCATGCCAATGCAAAAGGTGG + Intergenic
1055384696 9:75748188-75748210 GGTCATGCCTATGCAAGAGGTGG - Intergenic
1056284002 9:85069804-85069826 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1056639503 9:88358373-88358395 GGTCACACTGATGCAAAAGGTGG - Intergenic
1057316403 9:93971654-93971676 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1058065581 9:100544930-100544952 GGTCATGCCGATGCAAAAGGTGG + Intronic
1058223076 9:102326269-102326291 GGTCATGCCAATGCAAGAAGTGG - Intergenic
1058310618 9:103497056-103497078 GGTCAGGCCAATGCAAATCAAGG + Intergenic
1058380502 9:104372162-104372184 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1058413451 9:104760766-104760788 GGTCAGGCTCATGCAAAAGCAGG - Intergenic
1058810077 9:108630774-108630796 GGTCACGCTGATGCAAAGGTGGG - Intergenic
1058940570 9:109809326-109809348 GGTCACGCTGATGCAAGAGGTGG - Intronic
1059482230 9:114600504-114600526 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1059570040 9:115424784-115424806 GGTCACACTGATGCAAAAGGTGG + Intergenic
1059587185 9:115619331-115619353 GGTCATGCTGATGCAAAAGAGGG + Intergenic
1060653505 9:125351702-125351724 GGTCACGCTGATGCAAGAGGTGG + Intronic
1203635373 Un_KI270750v1:105834-105856 GGTCATGCTGATGCAAGAGATGG + Intergenic
1186266568 X:7840274-7840296 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1186704566 X:12127947-12127969 GGTCATGCCAATGCAAGATGTGG + Intergenic
1187615711 X:20991424-20991446 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1188196466 X:27240782-27240804 GGTCACGCCAATGCAAGAGGTGG - Intergenic
1188397851 X:29706616-29706638 GGTCATGCTGATGCAAAAGATGG + Intronic
1188660491 X:32752301-32752323 GGTCATGCTGATGCAAGAGAGGG - Intronic
1189707316 X:43771879-43771901 GTTCACGCACCTGCAAAAGAAGG - Intronic
1190950686 X:55140062-55140084 GGGCACACCGATGCAAAGGATGG - Intronic
1191170995 X:57447205-57447227 GGTCACGCTGATGCAAGAGGTGG + Intronic
1191603706 X:63039553-63039575 GGTCAGGCCGATGCAAAAAGTGG - Intergenic
1192689752 X:73349711-73349733 GGTCACACTGATGCAAGAGATGG - Intergenic
1192982937 X:76366674-76366696 GGTCACAATAATCCAAAAGATGG + Intergenic
1193004056 X:76596331-76596353 GGTCACACTAATGCAAGAGTTGG + Intergenic
1193316472 X:80071489-80071511 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1193541789 X:82781734-82781756 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1193816142 X:86107130-86107152 GGTCACACGGATGCAAAAGGTGG + Intergenic
1193841973 X:86418083-86418105 GGTCACACTGATGCAAAAGGTGG + Intronic
1193891029 X:87046143-87046165 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1194297451 X:92143930-92143952 GGTCACGCGGATGCAAGAGGTGG - Intronic
1194463125 X:94197174-94197196 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1194507139 X:94746296-94746318 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1194756371 X:97743721-97743743 GGTCATGCTGATGCAAGAGATGG - Intergenic
1194828896 X:98596695-98596717 GGTCACACTGATGCAAAAGGTGG + Intergenic
1194864973 X:99054271-99054293 GGTCACACTGATGCAAAAGGTGG - Intergenic
1194906009 X:99576786-99576808 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1195392347 X:104375777-104375799 GTTATAGCCAATGCAAAAGAAGG - Intergenic
1195823619 X:108973117-108973139 GGTCACGCTAATGCAAGAGGTGG - Intergenic
1196169851 X:112575196-112575218 GGTCACGCTGATGCAAAAGGTGG - Intergenic
1196368229 X:114946816-114946838 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1196480520 X:116141938-116141960 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1196558582 X:117120694-117120716 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1197057265 X:122135790-122135812 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1197089556 X:122520858-122520880 GGTCATGCTGATGCAAGAGATGG + Intergenic
1197431822 X:126376443-126376465 GGTCATGCTGATGCAAGAGACGG + Intergenic
1197914638 X:131521421-131521443 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1197975732 X:132163793-132163815 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1198551735 X:137752305-137752327 CATCACCCAAATGCAAAAGAAGG - Intergenic
1198569837 X:137942750-137942772 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1198608754 X:138373507-138373529 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1198707288 X:139462684-139462706 GGTCATGCTGATGCAAAAGATGG - Intergenic
1198804030 X:140475755-140475777 GGTCACACTGATGCAAGAGATGG - Intergenic
1198882470 X:141295946-141295968 GGTCACGCAGATGCAAAAGGTGG + Intergenic
1198942038 X:141966434-141966456 GGTCACACTAATGCAAGAGATGG - Intergenic
1198966943 X:142237354-142237376 GGTCACCCTAATGCAAGAGGTGG - Intergenic
1199020386 X:142870958-142870980 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1199071224 X:143477406-143477428 GGTCACATCAATGCAAGAGGTGG - Intergenic
1199220258 X:145309210-145309232 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1199301661 X:146220793-146220815 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1199357238 X:146876166-146876188 GGTCACGCTGATGCAAGAGCTGG - Intergenic
1199362830 X:146943069-146943091 GGTCACACTGATGCAAAAGCTGG + Intergenic
1199566159 X:149217519-149217541 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1199619479 X:149686415-149686437 GGTCACGCTGATGCAAGAGGTGG - Intergenic
1199869849 X:151888482-151888504 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1199909714 X:152272283-152272305 GGTCATGCCGATGCAAGAGGTGG - Intronic
1200380787 X:155834965-155834987 GGTCATGCTGATGCAAGAGATGG - Intergenic
1200571837 Y:4841486-4841508 GGTCACGCTGATGCAAGAGGTGG + Intergenic
1200615022 Y:5368831-5368853 GGTCACGCTGATGCAAGAGGTGG - Intronic
1201751276 Y:17434954-17434976 GGTCACGATAAAGCAAGAGAAGG + Intergenic