ID: 1072839090

View in Genome Browser
Species Human (GRCh38)
Location 10:98750574-98750596
Sequence CGGTAGAAGTGGTTGGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072839086_1072839090 -3 Left 1072839086 10:98750554-98750576 CCAGGGTGGTAGCAGCAGAGCGG 0: 1
1: 0
2: 3
3: 31
4: 259
Right 1072839090 10:98750574-98750596 CGGTAGAAGTGGTTGGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072839090 Original CRISPR CGGTAGAAGTGGTTGGTTTC TGG Intronic
No off target data available for this crispr