ID: 1072841355

View in Genome Browser
Species Human (GRCh38)
Location 10:98777750-98777772
Sequence AAGAAGAAGGACAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1956
Summary {0: 1, 1: 0, 2: 23, 3: 262, 4: 1670}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072841355 Original CRISPR AAGAAGAAGGACAAGGAGGC AGG (reversed) Intronic
900349808 1:2228911-2228933 AAGGAGAGCGCCAAGGAGGCGGG + Exonic
900424153 1:2568444-2568466 AAGCAGACGGACGGGGAGGCGGG - Intergenic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
900895999 1:5483405-5483427 AAGAAGAATAACCAGGTGGCTGG - Intergenic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901182628 1:7352125-7352147 AAGGAGGAGGAGAAGGAAGCAGG + Intronic
901382219 1:8882044-8882066 AAGAAAAAAGAAATGGAGGCCGG + Intergenic
901472920 1:9470224-9470246 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901658616 1:10785014-10785036 AGAAAGAAAGACAAGAAGGCAGG - Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903087563 1:20876241-20876263 AAAAAAAAAGACAAGGAGGGAGG + Intronic
903145807 1:21371258-21371280 AAGAAGAAGAAGAAGGAGTTGGG + Intergenic
903196850 1:21696447-21696469 AAGAAGAAGGGAAAGAAAGCGGG + Intronic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
903899985 1:26637165-26637187 AATAAGAAAGTAAAGGAGGCCGG - Intergenic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904298136 1:29536691-29536713 AAGAAGGAAGACAGGAAGGCAGG - Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904308906 1:29612559-29612581 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904849779 1:33448592-33448614 AAAAAGAAGTAGAAGAAGGCAGG + Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905227368 1:36488059-36488081 GAGAACAAAGACATGGAGGCTGG + Intergenic
905387117 1:37612840-37612862 AGGAAGGAGAGCAAGGAGGCGGG - Exonic
905435782 1:37954271-37954293 AAGGAGATGGACAAGAAGCCTGG - Intergenic
905575804 1:39043745-39043767 AAGAAGGAGGAGGAGGCGGCAGG + Intergenic
906176283 1:43775986-43776008 AAGAAAAAGGAATAGAAGGCAGG - Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906334846 1:44920014-44920036 AAGAAAAAGGACATTCAGGCCGG - Intronic
906372225 1:45263852-45263874 AAGAAGCAAGACAAGGAAGAAGG + Intronic
906472097 1:46139671-46139693 AAGAGGAAAGACGAGGAGGATGG - Intronic
906646579 1:47479393-47479415 GAGGAGAAGGACAAGGCAGCGGG - Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
907198138 1:52703766-52703788 AAAAAAAAGGGCCAGGAGGCCGG + Intergenic
907246312 1:53111273-53111295 GACAGGAAGGACAACGAGGCGGG + Intronic
907264706 1:53250520-53250542 AAGAAAAAAGACAGGGAGGGAGG + Intronic
907303528 1:53502190-53502212 GAAGAGAGGGACAAGGAGGCGGG + Intergenic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907621282 1:55983437-55983459 AAGGAGAAGGACAAGGCGAAGGG + Intergenic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
907770084 1:57452846-57452868 AAGAAGGAAGAAAAGGAGGAAGG + Intronic
907773904 1:57493725-57493747 AAGAAGAAAAAGAGGGAGGCAGG + Intronic
907821471 1:57974039-57974061 TGGATCAAGGACAAGGAGGCAGG - Intronic
907980962 1:59480398-59480420 AGGAAGAAGGACAAGGACAAAGG + Intronic
908295972 1:62713443-62713465 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
908353157 1:63306225-63306247 AATAAGGAGGAGAAGGAGGAAGG + Intergenic
909431679 1:75595089-75595111 AAGAAGAAAGAAAGGGAGGTAGG + Intronic
909646427 1:77922062-77922084 AATAAAAAGGTCCAGGAGGCTGG - Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909684483 1:78331857-78331879 AAGAAGAAAGAGAAGGAGAGAGG - Intronic
909775214 1:79476745-79476767 GAGAAAAAGTACAAAGAGGCAGG + Intergenic
909913224 1:81285913-81285935 AAAAAGAAGGAAAAGAAGCCTGG - Intergenic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910505793 1:87948994-87949016 AAGCAAAAGGAAGAGGAGGCAGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910798724 1:91123901-91123923 AGGAAGAAGGAAAAAGAGCCTGG + Intergenic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911335769 1:96578307-96578329 AAGAAGAAAGAAAAGAAGGAAGG + Intergenic
911427798 1:97742268-97742290 CAAAAGAATGACAAGGAGACTGG - Intronic
911504641 1:98733487-98733509 AAGGAAAAGGACAGAGAGGCAGG - Intronic
911537519 1:99118231-99118253 AAGATGAAGGACAAAAAGGTGGG + Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912089625 1:106055200-106055222 AAGAAAATGGATAAGCAGGCAGG + Intergenic
912140047 1:106713665-106713687 AAGAAGAAAGACAGGAAGGAAGG - Intergenic
912179049 1:107195675-107195697 AACAAGGAGGACAATGTGGCTGG - Intronic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912233748 1:107825500-107825522 AAGAGGAAGGAAATGTAGGCAGG + Intronic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
912687253 1:111777293-111777315 AAGAAGTAGGAAAAGGAGGTAGG + Intronic
912839454 1:113026049-113026071 AACAAAAATGACAAGGGGGCCGG + Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913234221 1:116766180-116766202 AGGGAGAAGGACAATGAGCCTGG + Intronic
913373794 1:118129647-118129669 AAGAAGGAAGAGAAGGAGGATGG - Intronic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914805908 1:150991529-150991551 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
914829013 1:151157146-151157168 AACAGGAAGGCCAAGGAGGAAGG + Intronic
914840128 1:151241504-151241526 AAGAAAAAGAAAAAGGGGGCAGG + Intronic
914846552 1:151286864-151286886 AGGAAGAGGGGAAAGGAGGCGGG - Exonic
914929890 1:151921619-151921641 CAGAAGAAAGATAAAGAGGCAGG + Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915035308 1:152918729-152918751 AAGAAGGAGGAGGAGGAGGGAGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915310119 1:155002382-155002404 AAGAAGGAGGGAAAGGAGGAGGG + Intergenic
915797640 1:158753441-158753463 AAGTAGAAGTAAAAGGAGGTTGG - Intergenic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916083464 1:161251572-161251594 AAGAGGAAAGACAAGGGTGCAGG + Intergenic
916410835 1:164545476-164545498 AAGATGGAGGAAAAGAAGGCTGG + Intergenic
916441050 1:164825050-164825072 AGGTAGAAGGACAGGAAGGCTGG - Intronic
916472731 1:165139776-165139798 AAGAAAAAAGAAAAGGAGGTGGG + Intergenic
916604661 1:166328821-166328843 AAGAAGAAGGGGAGGGATGCTGG - Intergenic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917367605 1:174249937-174249959 ATGAAGAAGGGCAAGAGGGCCGG - Intronic
917938607 1:179893965-179893987 AAGAATAAAGACAACAAGGCCGG + Intronic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918373697 1:183887187-183887209 AAGAAGGAGGGGAAGGAGGGAGG - Intronic
918469983 1:184861800-184861822 AAGAAGAGAGAGAAGGAGGGAGG + Intronic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919562437 1:199138529-199138551 AAGATAACGGTCAAGGAGGCAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920433002 1:205930656-205930678 AAGAGGATGGAAAAGTAGGCAGG - Intronic
920541256 1:206779797-206779819 AAGAAGAAAGTCAATGAGGCTGG - Intergenic
920634441 1:207686035-207686057 AAGAAGGAAGGCAAGCAGGCAGG - Intronic
920649624 1:207827046-207827068 AGGAAACAGGACAGGGAGGCCGG - Intergenic
920850482 1:209624963-209624985 AAAAAGAAGGAAAAGAAGGAAGG + Intronic
921101190 1:211930830-211930852 AAAAAGAAGGGCCAGGAGGGAGG + Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
921326347 1:213989010-213989032 AAGAGAAAGGACAAGGGGACCGG - Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921433709 1:215091883-215091905 TAGAAGAACTACAAGGATGCTGG + Intronic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922531309 1:226347346-226347368 AAGAAAGAGGGCAAGGGGGCTGG + Intergenic
922592839 1:226791519-226791541 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922886634 1:229025416-229025438 AAGATGACAGACAAGGATGCTGG - Intergenic
922918434 1:229278222-229278244 AAAAAGAAGGACGAGGTGGAAGG - Intronic
923016514 1:230130637-230130659 GAGCAGAAGGACAAGCAGCCCGG + Intronic
923072434 1:230577883-230577905 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
923332967 1:232942622-232942644 AAGAAGAGAGGGAAGGAGGCAGG + Intergenic
924061374 1:240178427-240178449 AAGAAGAAGAAGAAGAAGGGGGG - Intronic
924433068 1:244013942-244013964 AAGAAGAAGGCCAAGAAAGAAGG - Intergenic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
924586238 1:245363490-245363512 AAGAAAAGAGAAAAGGAGGCCGG - Intronic
924608668 1:245556296-245556318 AAGAAGGAGGAGGAGGAGGGAGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
924736472 1:246761369-246761391 AATAAGAAGAAAAAAGAGGCCGG - Intronic
924758861 1:246966094-246966116 AAGAATAAGGGCAAAGAGCCTGG + Intronic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063057056 10:2517066-2517088 AAGAAGCAGGATAAGGAAGGAGG - Intergenic
1063057221 10:2518961-2518983 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063096919 10:2916245-2916267 AAGACCAAGAACCAGGAGGCAGG + Intergenic
1063446113 10:6118462-6118484 AAGAAAAAAAAAAAGGAGGCCGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063847246 10:10144336-10144358 AAGATGAAGGAGATGGTGGCTGG - Intergenic
1064104635 10:12490550-12490572 AAGAAAAACCACAAAGAGGCTGG + Intronic
1064119622 10:12607223-12607245 AAGAAGAAAGGGAGGGAGGCCGG - Intronic
1064210589 10:13357596-13357618 AAAAAGAAAGAAAAGTAGGCCGG - Intergenic
1064213616 10:13381529-13381551 TTCAAGAAGGAAAAGGAGGCTGG + Intergenic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1064686512 10:17867312-17867334 AAGAAGAAGAAGAAGGAAGGAGG - Intronic
1064689964 10:17906388-17906410 AAGAGGAAAGACAAAGAGGAAGG - Intronic
1064850290 10:19701777-19701799 AAGAAGGAGGAAAAGGGGGAGGG - Intronic
1065050373 10:21785800-21785822 AAAAAGATGGAAAAGGAGGAGGG + Intronic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065316160 10:24465826-24465848 AAGATGAAGGACGAGAAGGTAGG - Intronic
1065595460 10:27306472-27306494 AAAATGGAGGCCAAGGAGGCTGG + Intergenic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1065747418 10:28855015-28855037 AGGTAGAAGGATAAGGAGGAAGG - Intronic
1065933491 10:30499989-30500011 AAGAAGGAGGGAAAGGAGGAAGG + Intergenic
1065947923 10:30624287-30624309 CAGAAGAAGGACACTGAGGTTGG + Intronic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1065967178 10:30779802-30779824 GAGAGGAAGCACAAGGAGGCAGG - Intergenic
1066114548 10:32227931-32227953 AAGAAGATGGAAAAGCAGACTGG - Intergenic
1066124421 10:32326141-32326163 AAGAGGAAGGATAAGGAAGTAGG - Intronic
1066142361 10:32518488-32518510 AAGTTGAAGGACAAAGAGGTTGG + Exonic
1066187183 10:33021591-33021613 ATAAAGAAGGAAATGGAGGCTGG + Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066409216 10:35149739-35149761 AAGAGGAAAGAAAAGCAGGCTGG - Intronic
1067150654 10:43730039-43730061 AAGAAGAAGAAGAAGAAGACAGG + Intergenic
1067161463 10:43828396-43828418 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1067305469 10:45060087-45060109 AAGTAGGAGGTCAAGGAGGCAGG + Intergenic
1067515113 10:46933120-46933142 AATAATAATGACAAGGAGGGCGG - Intronic
1067557813 10:47284874-47284896 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067557819 10:47284894-47284916 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1067647143 10:48118690-48118712 AATAATAATGACAAGGAGGGCGG + Intergenic
1068056380 10:52016869-52016891 GAGAAGAAGGAAAGGGAGGAGGG + Intronic
1068349145 10:55820745-55820767 AGGAAGAAAGGAAAGGAGGCAGG + Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068959147 10:62849279-62849301 AACAAGGAGGCCAGGGAGGCTGG - Intronic
1069409476 10:68138396-68138418 AACAAGAAAGAAAAAGAGGCCGG - Intronic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1069455390 10:68549924-68549946 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069667372 10:70171782-70171804 AAAATGAAGAACAAGGAGGTGGG + Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070360144 10:75680355-75680377 AAGAAGAAGGAAAGGGGGGATGG + Intronic
1070424310 10:76270607-76270629 AAGCAGAAGGAAAAGAAGACAGG - Intronic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070524468 10:77283334-77283356 AGGAGGAGGGAGAAGGAGGCAGG + Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071718508 10:88120203-88120225 AACAAGAAGGAAAGGGAAGCAGG + Intergenic
1071794324 10:88989432-88989454 AAGAAGTGGGATAAGGAGGATGG - Intronic
1071825645 10:89322782-89322804 GAGAAGTAGGACCAGTAGGCTGG - Intronic
1071952273 10:90717372-90717394 ATGAAGAAGGAAAAGGAGCATGG + Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072119481 10:92393981-92394003 AAAAAAAAGGACAAAGAGGCTGG - Intergenic
1072136628 10:92553125-92553147 AAGAAAAAGAAAAAGCAGGCTGG + Intronic
1072695290 10:97598977-97598999 AAGAGGCAGAACAAGGAGACAGG - Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073048949 10:100655867-100655889 AAGGAGGAGGACGAGGAGGAAGG - Intergenic
1073220512 10:101868564-101868586 AGGAAGGAGGACAGGGAGGGAGG - Intronic
1073305381 10:102499740-102499762 CAGAAGAAGCACAAAGAGCCTGG + Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073748881 10:106501274-106501296 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
1073833554 10:107414934-107414956 AAGAAGAAAGAGAAGGAAGTTGG + Intergenic
1074002732 10:109388685-109388707 AAGAAGGAAGAAAAGTAGGCAGG + Intergenic
1074223368 10:111460181-111460203 TAGAAAGAGGACAAGGAGTCTGG - Intergenic
1074291428 10:112140445-112140467 AACAAGAAGGCTGAGGAGGCTGG + Intergenic
1074685861 10:115961987-115962009 AAGGAGAGGGGCAAGGGGGCAGG - Intergenic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1075295706 10:121273128-121273150 AAGAAGAAGGAAAAGGCCTCTGG + Intergenic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1075344913 10:121674874-121674896 AAGAAGAACGGGAAGGAGACTGG - Intergenic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1076267145 10:129117674-129117696 GAGAAGAAGGACCAAGAGACAGG + Intergenic
1076489709 10:130850072-130850094 AAGATGAAGGAGAAGGAGAGGGG - Intergenic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076809181 10:132877912-132877934 AAAGAGAAGGACAAGGAGAAGGG - Exonic
1076809432 10:132878943-132878965 GAGGAGCAGGACAAGGAGGGGGG + Intronic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077392564 11:2306887-2306909 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078173541 11:8950137-8950159 AAGAAAAAAAAAAAGGAGGCAGG + Intronic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078285433 11:9949101-9949123 AAGAAGAAGGAATGGGAGGGGGG + Intronic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078892173 11:15567295-15567317 AGGAAGAAAGAAAAGGAGGAAGG - Intergenic
1078914296 11:15763806-15763828 AAGAAGAGAGAGAAGGAGGGAGG + Intergenic
1079084150 11:17433313-17433335 AAGCAGAGGGACCAGGAGTCAGG + Intronic
1079347895 11:19668993-19669015 AAAATGAAGGACAAGCAGACAGG + Intronic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1079432374 11:20405105-20405127 AAGAAGGAAGAAAAGGAGGCTGG - Intronic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079469608 11:20765684-20765706 AAGAAGGAGGCCAAGAAGGAGGG + Intronic
1079471302 11:20780749-20780771 AAGCTGAAGGAGAAGGAGTCAGG + Intronic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080569193 11:33541101-33541123 AGGCAGACAGACAAGGAGGCAGG - Intergenic
1080635943 11:34123273-34123295 AGAACGAAGGACAAGGAGTCAGG - Intronic
1081006898 11:37755753-37755775 CAGATGAAGGACCAGCAGGCTGG - Intergenic
1081318854 11:41665930-41665952 AAGAAGAGGGAAAATAAGGCTGG - Intergenic
1081352293 11:42069006-42069028 AAGAAGAAGGAAAAGAAGTGAGG + Intergenic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1081800921 11:45858803-45858825 ATGAAGATGGCCAAGGAGGCTGG + Exonic
1081997856 11:47376624-47376646 AAGAAGGAGGACAGGGAAGAGGG - Intronic
1082123182 11:48402541-48402563 AAGAACAAGCACAAGGGGTCAGG + Intergenic
1082556880 11:54573823-54573845 AAGAAAAAGCACAAGGGGTCAGG + Intergenic
1082672225 11:56047629-56047651 AAGAAGAAAGAGAGGGGGGCAGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082756016 11:57077452-57077474 AAGAAGAAGAAAAAAAAGGCAGG + Intergenic
1082764899 11:57159565-57159587 AGTAAGAAGCACATGGAGGCTGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082928117 11:58572946-58572968 AAAAAGAAGGACAAATAGGCCGG + Intronic
1083047334 11:59748805-59748827 AGGAAGAAGTACATGGAGGCTGG - Intronic
1083091652 11:60206093-60206115 AAGCAGAAGGAAAAGGATGGGGG + Intronic
1083107142 11:60369156-60369178 AACAAGAAGGAAAAGAAGGACGG - Intronic
1083270464 11:61569714-61569736 GAGAGGAAGGACAGGGAGGAAGG + Intronic
1083443281 11:62690735-62690757 AAGGAGAAAGCCAAGGAGTCAGG + Intronic
1083556604 11:63634208-63634230 AAGAAGAAAAAAAAGGGGGCTGG + Intronic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083831217 11:65234983-65235005 AGGAAGAAAGAAAAGGAGGGAGG - Intergenic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084214422 11:67639824-67639846 AAGAGGGAGGACAAGGAGGGAGG - Intergenic
1084287299 11:68140589-68140611 AAGGAGGAGCTCAAGGAGGCAGG + Intergenic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084892310 11:72242641-72242663 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1085080305 11:73628465-73628487 AAGCAGGAAGACTAGGAGGCAGG - Intergenic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085750348 11:79155758-79155780 AGGAAGAAGAGAAAGGAGGCAGG - Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086318955 11:85624861-85624883 AAGAAGAAAGGGAAGGAGGGAGG + Intronic
1086554309 11:88091064-88091086 AAGAAAAAGGACCAGGAGAAGGG + Intergenic
1086578698 11:88371022-88371044 AAGAAAAAGAACTTGGAGGCAGG - Intergenic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086890263 11:92249483-92249505 AAAAAGAAAGAAAAGCAGGCAGG - Intergenic
1086965602 11:93024625-93024647 AAGAAGGAGGAAAAGCAGGCAGG + Intergenic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087283854 11:96243302-96243324 AGGAAGCAGAGCAAGGAGGCGGG + Intronic
1087391768 11:97544104-97544126 AAGAAGAAGGACAAAGTTGGAGG + Intergenic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088646760 11:111923785-111923807 AAAAACAAGGACAAGGAAGCAGG + Intronic
1088807440 11:113365360-113365382 AAGAAGGAGGATAAAGAGACAGG - Intronic
1088883703 11:113991128-113991150 AAGAAGAAACACTAGGAGGTGGG + Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089399546 11:118156547-118156569 AAGAGGAGGGAGAGGGAGGCAGG - Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089629136 11:119773011-119773033 AAGAACAAGGTCAGGGAGGCTGG - Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090721355 11:129476645-129476667 AAGAAGGAGGGAAAGGAGGGAGG - Intergenic
1090840559 11:130484212-130484234 AAGAAAAACGAAAAGGAGGAAGG + Intergenic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1091061591 11:132468099-132468121 AAGCAGAAAGAGAGGGAGGCTGG - Intronic
1091127447 11:133113407-133113429 AGGGAGAAGAACAAGGAAGCAGG + Intronic
1091130619 11:133144045-133144067 AAGATGAGACACAAGGAGGCAGG - Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1091398920 12:171198-171220 GAGAAGAAGAACAAGGGGGCAGG - Intronic
1091500740 12:1015058-1015080 AAAAAGAAAGAAAAAGAGGCAGG - Intronic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092149532 12:6237653-6237675 AAGAAAAATGACAAGGAGAATGG - Intronic
1092208573 12:6631812-6631834 AAGAGAAAGGACCAGGGGGCTGG + Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092329971 12:7576420-7576442 AAGAAGAAGGACAAAGTTGGAGG + Intergenic
1092464676 12:8719910-8719932 AAGGAGACTGACAAGGAGTCTGG + Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1092856773 12:12681347-12681369 AAGAAGAGGGACAATGAGCATGG - Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093204661 12:16232971-16232993 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093508370 12:19896595-19896617 AAGAAGAAAGAAGAGGAGGAAGG - Intergenic
1093508404 12:19896785-19896807 AGGAAGAAGGAGAAGGAAGGAGG - Intergenic
1093684353 12:22039612-22039634 AAGCAGCAGCACAAGTAGGCAGG + Intergenic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094192602 12:27712237-27712259 GGGAAGAAGGACAATGTGGCAGG + Intronic
1094432212 12:30381762-30381784 AAGAAGAAGAACAAAGATGGAGG + Intergenic
1094459579 12:30680104-30680126 AAGAAGAAGGAAAAGAAGAAGGG - Intronic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1094628261 12:32146923-32146945 AAGAAGAAGGAGGAGGAAGGAGG - Intronic
1095566732 12:43633273-43633295 AAGAAGATAGACAAGGTAGCTGG + Intergenic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095824746 12:46519461-46519483 GAGAAGAAAGAAAAAGAGGCAGG - Intergenic
1095897967 12:47299784-47299806 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096101580 12:48973242-48973264 AAGAAAAAGGATAAGGACACTGG - Intergenic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096286118 12:50302076-50302098 AAAAAAAAAAACAAGGAGGCTGG + Intergenic
1096317925 12:50584950-50584972 ACGAAGCAGGAGAAGCAGGCAGG - Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096565439 12:52473794-52473816 GAGAAGCAGGACAAGGAATCGGG + Intergenic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096682686 12:53267323-53267345 AAAAAGAAAGAAAAGAAGGCCGG - Intergenic
1096696393 12:53351633-53351655 AAGAAGGTGGGCAGGGAGGCCGG + Intergenic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097012675 12:55964600-55964622 AAGAAAAGAGATAAGGAGGCCGG - Intronic
1097145514 12:56936903-56936925 AACAAGAGGGAGGAGGAGGCAGG - Intergenic
1097548038 12:61029303-61029325 AAGGAGAAGGAGAAGAAGACAGG - Intergenic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098137342 12:67416556-67416578 AACTAGAAGGAAAAGGAGGGAGG - Intergenic
1098187684 12:67915608-67915630 AGAAAGAAGGACCAGGAGGCCGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098271312 12:68772928-68772950 AAGAAGCAGGTCAAGGGGGTGGG + Exonic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098395033 12:70008021-70008043 AAGAAGCAGGAAAAAGAGGCGGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098772971 12:74577985-74578007 AAGAAAAAGAACAAAGAAGCAGG + Intergenic
1098783436 12:74718348-74718370 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099398440 12:82170985-82171007 AAAAAGAAGGAGGAGGAGGGAGG + Intergenic
1099695631 12:86015103-86015125 CAGAAGTAGGACACAGAGGCCGG - Intronic
1100023209 12:90096736-90096758 AAGTAGTAGGACAGGCAGGCAGG + Intergenic
1100030593 12:90185492-90185514 AAGAAGAAATACATGGAGACAGG - Intergenic
1100207186 12:92363590-92363612 GAGAAGAATGAGGAGGAGGCAGG - Intergenic
1100273601 12:93049547-93049569 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100835610 12:98564365-98564387 AAGAAAACAGACAAAGAGGCCGG + Intergenic
1100877271 12:98975308-98975330 AAGAAGGAGGAAAAGGAAGAAGG - Intronic
1100944965 12:99771787-99771809 AAAAAGCAGGCCAAGGAGGTAGG + Intronic
1100958977 12:99941897-99941919 AAGAAGGTGGACAGGGAGGACGG + Intronic
1101344501 12:103873690-103873712 AAAAAGAAGGCCAATGTGGCTGG + Intergenic
1101376719 12:104177798-104177820 CAGAAGAGGCACAGGGAGGCAGG - Intergenic
1101438293 12:104682927-104682949 GAGAAGAAGGACAGAGAGTCAGG - Intronic
1101725957 12:107388423-107388445 AAAGAGAAAGACAAGGAAGCAGG - Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102471917 12:113164080-113164102 AAGGAGGAGGAGGAGGAGGCGGG - Exonic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102792313 12:115657774-115657796 AAGAAGGAGGATGAGGAGGAGGG - Intergenic
1102792326 12:115657817-115657839 AAGAAGGAGGACGAGGAAGAAGG - Intergenic
1102832284 12:116014546-116014568 AAGAAGAAAGGCAGGGAGACTGG + Intronic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102908447 12:116694873-116694895 AGGAAGAGGGAGGAGGAGGCAGG + Intergenic
1102991980 12:117322251-117322273 AAGAGGAAGGGAAAGGAGGGAGG - Intronic
1103070209 12:117935122-117935144 AAGAAGAAGAATAAGAAGGCAGG - Intronic
1103099844 12:118164025-118164047 ATTAAGAAGGTCAAGGAGCCTGG + Intronic
1103172802 12:118836088-118836110 ATGGAGATGGACAAGAAGGCAGG - Intergenic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103522643 12:121546697-121546719 AAAAAAAAAGACAAAGAGGCTGG - Intronic
1103746402 12:123127593-123127615 AAAAAGAAAGAAAAAGAGGCAGG - Intronic
1103767334 12:123290050-123290072 AAGAAGAAGCCCAAAAAGGCGGG - Exonic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104092698 12:125529078-125529100 AAGAAGAAGGAAGAGGAAGGAGG - Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104386294 12:128354448-128354470 AGGAAGAAAGAAAAGAAGGCAGG - Intronic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104703431 12:130924677-130924699 AAGAAGAAGAAGAAGAAGACTGG - Intergenic
1104710511 12:130982534-130982556 AAGAAGAAGGAAGAAGAGGAGGG - Intronic
1104768539 12:131345965-131345987 GAGAAGAAGGGCAAGGTGGCAGG + Intergenic
1104903195 12:132200054-132200076 GAGTAGAAGCACAGGGAGGCTGG + Intronic
1105056034 12:133099971-133099993 AAGAAAAAGAACAAGGAGAGTGG - Intronic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106208090 13:27618201-27618223 AAGAGGTATGACTAGGAGGCTGG - Intronic
1106438769 13:29746907-29746929 AACAAGAATGACAAGGAGTAGGG + Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106538357 13:30667893-30667915 AAGAAAAAAGACCAGGAGGAAGG + Intergenic
1106656192 13:31749374-31749396 AAGAAGGAGAACAAGGAGAGAGG - Intronic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106872782 13:34039637-34039659 AAGAAGAAGGAAAAAGAGAAGGG - Intergenic
1107131388 13:36900067-36900089 GAGTAGAAGGAAAAGAAGGCAGG - Intronic
1107417656 13:40216432-40216454 AAGATGAATGGCAAGGGGGCTGG - Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108040923 13:46338665-46338687 AAGAACAAGACCATGGAGGCAGG + Intergenic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108134022 13:47335459-47335481 AAGAAATAGGAAAAGGGGGCCGG - Intergenic
1108410229 13:50138426-50138448 AAGAAGATGGATGAGGAGGAGGG + Intronic
1108427503 13:50318820-50318842 AAGCAGGAGGAAAAGGAAGCAGG - Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1110244241 13:73303658-73303680 AAGAAGAAGGAGGAGGAGCTAGG - Intergenic
1110490332 13:76096051-76096073 AAGAAAAAGGGAAGGGAGGCAGG - Intergenic
1110666159 13:78119493-78119515 GAGGAGGAGGACAAGGAGGGAGG - Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1111942773 13:94630630-94630652 TTGATGAAGGACAATGAGGCTGG - Exonic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112046388 13:95602244-95602266 AGTAAGAAGGAAAAGGTGGCAGG - Intronic
1112262982 13:97894683-97894705 AAGAAGGAGGCCAAGGAGTGAGG + Intergenic
1112350984 13:98632823-98632845 AAGAAACAGAAAAAGGAGGCCGG - Intergenic
1112724136 13:102282348-102282370 AAGAAGTAGGGATAGGAGGCTGG - Intronic
1112744840 13:102514894-102514916 AAGAAGAAGGAAGAGGAGCAAGG + Intergenic
1112869547 13:103953273-103953295 AGGAAGAAGGAAAAGGGTGCAGG - Intergenic
1113303875 13:109054965-109054987 AAGAAGGAGGAAAAGGAGGGAGG - Intronic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113835868 13:113328168-113328190 AAGGACAGGGACAAGGAGCCTGG - Intronic
1113898838 13:113784548-113784570 AAGAAGAAGGAGGAGAAGGGAGG + Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114490752 14:23100259-23100281 AAGAAGAAGAAAAAGGTGGGGGG + Exonic
1114863841 14:26562517-26562539 AAGCAGAAAGACAAGGAGAAGGG + Intronic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1115300646 14:31881544-31881566 GAGGAGAAGGACAAGGTGACGGG - Intergenic
1115329029 14:32173856-32173878 AAGAAGAAAGACAAAGAGGGAGG - Intergenic
1115516288 14:34188268-34188290 AAGCAGAAGAACTAGGATGCAGG - Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115841260 14:37473220-37473242 AGGAAGCAGGAGAAAGAGGCGGG - Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117390946 14:55262011-55262033 AAGAATAAGGACAGGCTGGCTGG + Intergenic
1117488852 14:56226084-56226106 AAGAAGAAGAAGAAGAAGTCAGG + Intronic
1117656181 14:57959047-57959069 AATAGGAAGGACAAGGAGAGAGG + Intronic
1118411123 14:65479541-65479563 AAGAAGAAAGGGAAGGAGGGAGG - Intronic
1119190989 14:72681589-72681611 AAGATGGAGGAAAAGAAGGCAGG - Intronic
1119345029 14:73916170-73916192 AGGAAGGAGGAAAAGGAGTCTGG + Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119714001 14:76845338-76845360 AAGAAGAAGGAAAAGAAGAAGGG + Intronic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120510783 14:85411789-85411811 AAGAAGAAGGAAATGTTGGCAGG + Intergenic
1120846049 14:89126008-89126030 AAGGAAAAGGACAAGGATGCAGG - Intronic
1120873144 14:89355911-89355933 AAGAACGGGGATAAGGAGGCAGG + Intronic
1121034460 14:90688901-90688923 AAGGAGAAGGGCTGGGAGGCTGG - Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121041609 14:90753616-90753638 AAGCAGAGGGACAGGGACGCCGG + Intronic
1121043223 14:90767519-90767541 AGAAAGAAGGAAAAGGGGGCTGG - Intronic
1121200615 14:92114116-92114138 ATAAAGAATTACAAGGAGGCTGG - Intergenic
1121510459 14:94509410-94509432 CCGAAAAAGGACTAGGAGGCTGG - Intronic
1121624574 14:95374808-95374830 AAGAAGAAAGAAAAGAAGGAGGG - Intergenic
1121683195 14:95811415-95811437 AAGAAGAAGGACAAGGAGCAGGG - Intergenic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1121908657 14:97769565-97769587 AAGCTGGAGGCCAAGGAGGCTGG + Intergenic
1121924904 14:97918474-97918496 AGGGAGAAGGACAAGGAAACAGG + Intergenic
1122012170 14:98759243-98759265 AGGAAGAAAGAAAAGGAGGGAGG - Intergenic
1122123775 14:99568408-99568430 GAGAGGAAGGCCAAGGAGGAAGG - Intronic
1122531665 14:102432107-102432129 AAGAAGAAGAAGAAGAAGACAGG + Exonic
1122621645 14:103061128-103061150 AAGAAAAAGAAAAAGAAGGCCGG + Intergenic
1122835058 14:104426788-104426810 AAAAAAAAGGGCCAGGAGGCAGG + Intergenic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125024816 15:35019522-35019544 AAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125134018 15:36320073-36320095 AAGAGTAAGTACAAGGAAGCTGG - Intergenic
1125253713 15:37737481-37737503 AAGGAGAAGGAAAAGCAAGCAGG - Intergenic
1125254819 15:37751411-37751433 AAGAGGAAGGAAAAAGAGGAAGG + Intergenic
1125311119 15:38379082-38379104 AAGAAGAAGAAGAAGAAGTCAGG - Intergenic
1125492070 15:40155740-40155762 CACAGGAAGGACTAGGAGGCAGG - Intergenic
1125639790 15:41221002-41221024 AAGAAGAAAGAAGAGGAGGCTGG - Intronic
1125811313 15:42543881-42543903 AAGAAAAAGGATCAGGAGACAGG - Exonic
1125871474 15:43106003-43106025 AAGATGGCGGACGAGGAGGCTGG - Exonic
1126343088 15:47665306-47665328 AAGAAGAATGAAAAGGAAGATGG - Intronic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126567121 15:50112423-50112445 AAAAAGCAGGCCAAGGAGGAAGG + Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1127029440 15:54845487-54845509 AAAGAGCAGGAAAAGGAGGCGGG + Intergenic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1127135878 15:55923033-55923055 AATAAGCTGGGCAAGGAGGCGGG + Intronic
1127272364 15:57413152-57413174 AGAAAGAAGGAGAAGAAGGCCGG - Intronic
1127506021 15:59598644-59598666 AATCAGAAAGACAGGGAGGCAGG + Intronic
1127591655 15:60431166-60431188 AAAAAGAAGAACATAGAGGCCGG - Intronic
1127674907 15:61229342-61229364 AAAAAGAAGGAGAAGGCGACCGG + Intergenic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128099107 15:64983688-64983710 AAGAAGAAAGCCAAGGAAACTGG + Intronic
1128257251 15:66206339-66206361 AAGAAGAAGAAAAAGAAAGCAGG + Intronic
1128275777 15:66352584-66352606 AAAAAGAAAAAAAAGGAGGCTGG - Intronic
1128460216 15:67861324-67861346 AAGATGGTTGACAAGGAGGCTGG + Intergenic
1128565054 15:68695575-68695597 AAGAATATGAACAAGGAGGGAGG + Intronic
1128638640 15:69319351-69319373 AAGCAGAAGTACAAGGAGCTGGG - Intronic
1128882338 15:71255198-71255220 AATCAGAAGGAAAAGGAGCCTGG - Intronic
1129198913 15:73986995-73987017 AGGCAGAAGGGCAAGGAGGCAGG + Intronic
1129601845 15:77003664-77003686 AAAAAGAAGAAGAAGGAAGCGGG + Intronic
1129785903 15:78309895-78309917 ATGACGAAGGAAAAGGAGGTGGG + Intergenic
1129917795 15:79289669-79289691 AAGGAGAAGGAAAAGAAGGTGGG - Intergenic
1130022231 15:80241304-80241326 GAAAAGAAGGAACAGGAGGCAGG - Intergenic
1130033091 15:80333488-80333510 AAGCTGGAGGCCAAGGAGGCTGG - Intergenic
1130398246 15:83523740-83523762 AAGAAGAGAGAGAAGGAGGGAGG - Intronic
1130401393 15:83557868-83557890 AAGACGCAGGACAGGGAGGATGG + Intronic
1130536271 15:84787145-84787167 TAGAAGATGCACAAGGAGGCGGG - Intronic
1130686532 15:86042460-86042482 GAGAAAAAGGACAAGGTGTCTGG - Intergenic
1130717112 15:86345892-86345914 AAGAAGAAGGCCAAGGAGTAAGG - Intronic
1130878173 15:88032227-88032249 CAGCAGAAGGACAAGGAGAGGGG + Intronic
1130942289 15:88521150-88521172 AACAAGAAGGCCAGGGTGGCTGG - Intronic
1130956281 15:88629515-88629537 GAAGAGAATGACAAGGAGGCTGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131075175 15:89490964-89490986 AAGACGAAGGACACGCTGGCAGG + Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131139824 15:89968112-89968134 AAGAAGGAGGAGGAGGAGGGAGG + Intergenic
1131282699 15:91033972-91033994 TCGAAGAAGGGCTAGGAGGCGGG - Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131465888 15:92654812-92654834 AAGAAGAAGAAAAAGTAGGCGGG + Intronic
1131683143 15:94744895-94744917 AAGGAGAAGGGAAAGGAGGGAGG + Intergenic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132080554 15:98861352-98861374 AAAGAGAAGGACTAGGAGGGCGG - Intronic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1133006764 16:2886502-2886524 AAAAAAAAGGACAAAGGGGCAGG - Intronic
1133128895 16:3664269-3664291 AAGAAGAAAGACACAGAGGTGGG - Exonic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133314018 16:4870903-4870925 AAGATGAAGAAAAAGGGGGCAGG + Exonic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1133460687 16:5984005-5984027 AAGAAGGAAGAAAAGGAGGAAGG - Intergenic
1133817656 16:9210468-9210490 AAGAAGAAGGAGCCAGAGGCTGG - Intergenic
1133827405 16:9290722-9290744 AAGAAGGAAGACTAGGAGTCTGG - Intergenic
1133846711 16:9461049-9461071 AAGAAGGAGGAAAAGGATGCAGG + Intergenic
1133961260 16:10495550-10495572 AAAAAGAGGGAGAAGGAGGGAGG - Intergenic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134287181 16:12872035-12872057 AAGAAGAAGGAGGAGGGGGGAGG - Intergenic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134676880 16:16096971-16096993 AAGAAGAGGGACATGAAGGCTGG - Intronic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134866337 16:17610695-17610717 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1134904850 16:17971580-17971602 AAGAAGAGGAAGAAAGAGGCAGG + Intergenic
1135086406 16:19478113-19478135 AATGAGAAGGCCAGGGAGGCTGG - Intronic
1135186070 16:20316942-20316964 ACGAGGAAGGAGAAGGAGGGAGG - Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135292015 16:21248002-21248024 AAGAAGAAAGAAAAGGATGTTGG - Intronic
1135394654 16:22122102-22122124 AAGAAGAAGGAAAAGAATGATGG + Intronic
1135470591 16:22726268-22726290 AAGAAAAAGAAAAAGGAAGCGGG - Intergenic
1135549497 16:23387280-23387302 AAAAAGAAGTAAAAGGTGGCTGG - Intergenic
1135612466 16:23880369-23880391 AAGGAGGGGGAGAAGGAGGCAGG - Intronic
1135660956 16:24296175-24296197 AGGAGGAAGGACCAGGAGTCGGG - Intronic
1135805740 16:25540859-25540881 AAAAAGAAGGAAAAGGATTCTGG + Intergenic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1135942428 16:26834220-26834242 AAGAAGAAGGAAGAGGAGGGAGG + Intergenic
1136017567 16:27412376-27412398 AAGGAGAAGGAGAAGAAAGCTGG - Intronic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1136452170 16:30359609-30359631 AAGAGCAAGAACAAGGAGGAGGG + Intronic
1136939665 16:34510988-34511010 AAGAAGGAGGAAAAGGAGGGCGG - Intergenic
1136960155 16:34837572-34837594 AAGAAGGAGGAAAAGGAGGGCGG + Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137622776 16:49887214-49887236 AAGTAGAAGGACGAGGAAGAGGG - Intergenic
1138044282 16:53704456-53704478 CAGAAGAAGGACAAGGAAATGGG - Intronic
1138153952 16:54685826-54685848 AGGAAGAAGGAAGAGGAGGAGGG - Intergenic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1138933868 16:61695073-61695095 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
1138991624 16:62397206-62397228 AAGAAGAAAGGAAAGAAGGCAGG + Intergenic
1139025354 16:62810249-62810271 AAGGAGAGAGAAAAGGAGGCAGG - Intergenic
1139060940 16:63250684-63250706 AAGAAGAAGGGGAAGGCGGAGGG + Intergenic
1139215181 16:65120801-65120823 AAAAAAACGGACAAGGAAGCCGG + Intronic
1139341346 16:66270038-66270060 AAGAAGAGAGACGAGGAGGGAGG + Intergenic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139491151 16:67286700-67286722 AAGAAGAAGGCAGAAGAGGCTGG + Intronic
1139656853 16:68393106-68393128 ATGAAAATGGACCAGGAGGCTGG + Intronic
1139938096 16:70585826-70585848 AAAAAAAAAAACAAGGAGGCTGG - Intronic
1139946390 16:70645171-70645193 AGGAAGGAGGAAAAGGAGGAAGG + Intronic
1140205092 16:72927292-72927314 GAGAAGGAAGACAAGGAGGAAGG - Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141158621 16:81613995-81614017 CAGAAGAAGGACAACTAGACAGG + Intronic
1141190905 16:81823967-81823989 AAAAAGAAGGAAAAGAAGGAAGG - Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141472091 16:84245823-84245845 AAGAAGAAGGGCAGAGAGGCAGG + Intergenic
1141549614 16:84796766-84796788 AAAAAAAAGAAAAAGGAGGCTGG - Intergenic
1141711412 16:85701386-85701408 AAGAAGAAGGAAAAAGATGAAGG - Intronic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141775825 16:86121963-86121985 AGGAGGAGGGACAAGGAGGAGGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1141934776 16:87229953-87229975 AAGGGCAAGGACAGGGAGGCAGG - Intronic
1142251140 16:88992628-88992650 CAGAGGAAGGCCAAGCAGGCCGG - Intergenic
1142513177 17:410613-410635 AAGAAGAAGACCAAGGGGTCTGG + Exonic
1142607385 17:1089661-1089683 AAGAAGAAGGAAATGCAGGCCGG + Intronic
1142872726 17:2831371-2831393 AAGAAAAAGAAATAGGAGGCTGG - Intronic
1143092692 17:4458370-4458392 AAGAAGAAAGAAAGGGAGGGAGG - Intronic
1143297758 17:5883880-5883902 AAGCAGGAGGAGATGGAGGCGGG - Intronic
1143360899 17:6370192-6370214 AATAAAATGAACAAGGAGGCCGG + Intergenic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1143949266 17:10619880-10619902 AAGAAGAAAGAAAAGAAGGGAGG - Intergenic
1144035034 17:11357217-11357239 AAGAAGAAGAAGAAGCAGGGAGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144360242 17:14485223-14485245 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1144429822 17:15181072-15181094 AAGAATAAGGACACACAGGCCGG - Intergenic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1144500400 17:15781545-15781567 AAGAAGTAAGAAAAGCAGGCCGG - Intergenic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1144746792 17:17621409-17621431 AAGAAGAAGGAAGAAGAGGAAGG + Intergenic
1144827446 17:18114102-18114124 AAGAAAAAGGACAAGAGGGAGGG - Intronic
1144964782 17:19070124-19070146 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144983185 17:19182054-19182076 AAATAGAAGGAAAAGGAGGAGGG + Intergenic
1144985040 17:19196185-19196207 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1145372701 17:22320412-22320434 TTTAAGAAGGACAAGGAGCCGGG + Intergenic
1145739360 17:27259683-27259705 AGGAGGAAGGACAAGCAGACAGG - Intergenic
1145799957 17:27676573-27676595 AGTAAGAAGGGCAAGGAGCCAGG - Intergenic
1145893506 17:28436354-28436376 AAGAAGTAAGTCAAGGAGGAAGG - Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146367121 17:32237802-32237824 AAAAAGCAGGACAAGGAAACTGG - Intronic
1146759025 17:35460190-35460212 AAGGAAAAGGACTAGAAGGCTGG - Intergenic
1146796862 17:35787783-35787805 AAGACTAAGGACAAAGGGGCTGG - Intronic
1146845350 17:36178777-36178799 AGCAAGAAGGGCAAGGAGCCCGG - Intronic
1146880924 17:36441708-36441730 AGCAAGAAGGGCAAGGAGCCCGG - Intergenic
1147065823 17:37922253-37922275 AGCAAGAAGGGCAAGGAGCCCGG + Intergenic
1147195360 17:38762921-38762943 AAGTAAAAGGACAAGGAGGATGG - Intronic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147254320 17:39173150-39173172 AAGAAAAAGAACCAGGAGGGAGG + Intergenic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147501966 17:40974493-40974515 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1147501980 17:40974551-40974573 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1147570836 17:41569854-41569876 AAGAAGAATCATAAGGAGGTAGG - Exonic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148482618 17:47970083-47970105 AAGACTGGGGACAAGGAGGCTGG - Intronic
1148609621 17:48955987-48956009 AATAAGAAGAAAAAAGAGGCCGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149209519 17:54287649-54287671 AAGAAGAAAGGCAAGGGTGCAGG + Intergenic
1149213301 17:54327898-54327920 AAGAAGAAAGGCAAGGGTGCAGG - Intergenic
1149309487 17:55380133-55380155 AAGAAAAAGGAAAAGAAGGTAGG + Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150654990 17:67033531-67033553 AAGAAGGAGGCCCAGGGGGCAGG + Intergenic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150801580 17:68287311-68287333 AAAAAGAAGAAGAAGAAGGCTGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151122745 17:71810597-71810619 ATCAAAAAGGATAAGGAGGCTGG + Intergenic
1151158775 17:72147057-72147079 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151728837 17:75899205-75899227 TGGAAGAAGGACAAGCCGGCTGG + Exonic
1151730293 17:75907080-75907102 AAACAAAAGGACAAGGTGGCCGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152516120 17:80825914-80825936 AAGTAGACGGAGACGGAGGCTGG + Intronic
1152598424 17:81249416-81249438 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152598447 17:81249488-81249510 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152673627 17:81624830-81624852 AAGCACAAAGACCAGGAGGCAGG + Intronic
1152784362 17:82240309-82240331 AGGGAGAAAGACGAGGAGGCAGG + Intronic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153318835 18:3751857-3751879 AAGAAGAAGAAGAAGAAGTCCGG - Intronic
1153615982 18:6933780-6933802 AAGAAGCGAGACAAGGGGGCCGG - Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153952048 18:10065804-10065826 AAGAGGGAGGCCAAGGGGGCAGG + Intergenic
1154111685 18:11574586-11574608 AAGAAGAAAGAAAAGGAAGGAGG + Intergenic
1154305356 18:13226865-13226887 AAGAGGGAGGATGAGGAGGCTGG - Intronic
1155057578 18:22198365-22198387 AACAAGAAGCATAAGCAGGCTGG - Intronic
1155148567 18:23104304-23104326 AAGAAGGAGGATCAGGAGGGAGG + Intergenic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155525645 18:26713769-26713791 AAGAATAGGGACCAGGAGACAGG + Intergenic
1155907410 18:31468508-31468530 AACAGAGAGGACAAGGAGGCAGG + Intronic
1155923438 18:31628924-31628946 TTGAAGATGGAAAAGGAGGCAGG - Intronic
1156037493 18:32782310-32782332 AGGAAGAAAGGCAAGAAGGCAGG - Intergenic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156328687 18:36098944-36098966 AAGAAGAAGAACAAGCGGCCGGG - Intergenic
1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG + Intronic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1156721743 18:40078639-40078661 AAGAAGAAAGGAAAGAAGGCCGG + Intergenic
1156862752 18:41857237-41857259 AGGAAGAAGTAGAAGGAGACGGG + Intergenic
1157165826 18:45357595-45357617 AAGAAGAAGGAAGGGGAGGAAGG + Intronic
1157193715 18:45602406-45602428 TTGAAGCAGGGCAAGGAGGCAGG + Intronic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157849485 18:51034545-51034567 AAGAAAAAGGAAAAAAAGGCTGG - Intronic
1157894806 18:51455682-51455704 AAGAGGAAGGATAAAGAGGAAGG + Intergenic
1158079995 18:53578613-53578635 AAGATGAAAAATAAGGAGGCTGG + Intergenic
1158087510 18:53670066-53670088 AAGAAAAAGGACAAAAAGGAGGG - Intergenic
1158159343 18:54462398-54462420 AAGAAGAAGGCCAGTGTGGCTGG - Intergenic
1158279592 18:55808249-55808271 AAGGAGAAGGACTAGGAAGCTGG - Intergenic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1158430840 18:57385879-57385901 AAGAAGATGCATAGGGAGGCTGG + Intergenic
1158582093 18:58692457-58692479 AGGAAGAGGGACAGGGAGGGAGG - Intronic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159110432 18:64049804-64049826 AAGAAGAAAGACAGGAAGGAAGG - Intergenic
1159116191 18:64115423-64115445 AAGAAGGAGGAAAATGAGGTAGG + Intergenic
1159125971 18:64225148-64225170 AAGAAGAAGACCAAGGACCCTGG - Intergenic
1159149575 18:64504257-64504279 AAAAAGAAGGAAAAGCAGGCAGG - Intergenic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159599088 18:70411556-70411578 AAGAAGAAAGAGAAAGATGCTGG - Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1160047336 18:75399207-75399229 AAGAAGAAAGTCAAGGAGGTAGG + Intergenic
1160065781 18:75573098-75573120 AACAAGAAAGAGAAGGAGCCAGG - Intergenic
1160232292 18:77057558-77057580 GTGAAGAAGGACAAGGAGAGAGG + Intronic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160370387 18:78368312-78368334 AAGCAGCAGCACACGGAGGCAGG - Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160925360 19:1542277-1542299 AAAAAGAAGGAGAAGGAAGGAGG - Intergenic
1161146610 19:2682679-2682701 AAGAAGAGCTACAGGGAGGCAGG + Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161428956 19:4219741-4219763 AAGGAGAAGGACAAGAAGGTGGG + Exonic
1161564032 19:4989635-4989657 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1161635116 19:5383649-5383671 AAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161674648 19:5638469-5638491 AATTAGAAGGACATGGTGGCAGG - Intronic
1161905847 19:7155944-7155966 AAGGAGGAGGAGAAGGAGCCAGG + Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1161955213 19:7490152-7490174 AAGGAAAAGGACATTGAGGCCGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162103047 19:8352188-8352210 AAGAAGAAAGAAAAAGAGGGAGG + Intronic
1162297440 19:9823003-9823025 ACGAAGAGGGAAAATGAGGCCGG + Intronic
1162310124 19:9901242-9901264 AAGAAGAAAGAAAGGGAGGGAGG + Intronic
1162398413 19:10430977-10430999 AAGAAGACGGGCGAGGAGGGCGG - Intronic
1162517462 19:11157474-11157496 AAGAAGGAAGAAAAGAAGGCCGG - Intergenic
1162583065 19:11542182-11542204 AAGAAGAAGAAGAAGAAGGTCGG - Intronic
1162748414 19:12812708-12812730 TAGAAGAGCGGCAAGGAGGCCGG + Intronic
1162873636 19:13604396-13604418 AAAGAGAAAGACAAAGAGGCCGG + Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163087805 19:14994823-14994845 AAGAAGAAAAATAAGCAGGCAGG + Intronic
1163113038 19:15172995-15173017 AAGAAGAAGGAAGAGGGGGAGGG - Intronic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163214782 19:15868434-15868456 AAGAAGAAAGAAAGGGAGGAGGG + Intergenic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163703960 19:18801527-18801549 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1163998570 19:21076136-21076158 AAGAAAAAAGAAAAAGAGGCCGG - Intergenic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164234935 19:23323582-23323604 GAAAAGAAGGAAAAGGAGGATGG - Intronic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1164535634 19:29084761-29084783 GAGAAGAAAGACTAGGAGGTGGG + Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164592462 19:29514065-29514087 AAGAGGGAGGATAAGGAGGAAGG + Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164839257 19:31380361-31380383 AAGAAGGAGGAAAGGGAGGCTGG - Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1164858312 19:31542575-31542597 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1164931190 19:32177546-32177568 AAAAAGAAGGAAAGGAAGGCAGG + Intergenic
1165050290 19:33137089-33137111 AAGAAGAAAGAAAATGAGCCAGG - Intronic
1165202418 19:34155899-34155921 AAAAAGCAGGACGAGGAGGCAGG + Intergenic
1165682442 19:37789471-37789493 AAGAAGAAGAAGAAGATGGCCGG + Intronic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165690920 19:37862544-37862566 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
1165936670 19:39393390-39393412 AAAAAAAAAGAAAAGGAGGCTGG - Intronic
1166084128 19:40464061-40464083 AAAAAGAAAGAAAAAGAGGCTGG - Intronic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1166432687 19:42740572-42740594 AACAGGAGGGACAAGGAGGCAGG - Intronic
1166435795 19:42765769-42765791 AACAGGAGGGACAAGGAGGCAGG - Intronic
1166445667 19:42855807-42855829 AGAAGGAGGGACAAGGAGGCAGG - Intronic
1166448657 19:42879769-42879791 AGAAGGAGGGACAAGGAGGCAGG - Intronic
1166453066 19:42917980-42918002 AGAAGGAGGGACAAGGAGGCAGG - Intronic
1166465341 19:43026561-43026583 AGAAGGAGGGACAAGGAGGCAGG - Intronic
1166471469 19:43082757-43082779 AGAAGGAGGGACAAGGAGGCAGG - Intronic
1166482612 19:43186592-43186614 AGAAGGAGGGACAAGGAGGCAGG - Intronic
1166492237 19:43269619-43269641 AGAAGGAGGGACAAGGAGGCAGG - Intergenic
1166609106 19:44173310-44173332 AAGAGGGAGGACAATGTGGCTGG - Intronic
1166624436 19:44337186-44337208 AAGAAGAAACACAAGAAGGAAGG - Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166692723 19:44833467-44833489 AAGAAGAAAGAAAAGGAAGGAGG + Intergenic
1166767183 19:45258706-45258728 AAAAAAAAAGACAAGGAGGTTGG + Intronic
1166881289 19:45931666-45931688 GAGACCAAGGCCAAGGAGGCTGG - Intergenic
1166882484 19:45937937-45937959 TAGGAGAGAGACAAGGAGGCTGG + Exonic
1166975648 19:46603573-46603595 AAGATGAGGGATAAGGAAGCAGG + Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167381377 19:49140136-49140158 AAGAAGAAAGAAAGGGAGGGAGG - Intronic
1167449839 19:49560615-49560637 AAGAAGAAGGACACAGGTGCAGG - Exonic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167633023 19:50637586-50637608 AGGAAGAAGGACAAGGTGACAGG + Exonic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167714241 19:51130924-51130946 CAGAAGAAGGCCCAGGAGGAGGG - Intronic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1167837302 19:52084803-52084825 AAGAAGAAAGAAAAGGAGCCAGG - Exonic
1167846357 19:52168074-52168096 AAGAGGAAAGAAAAGGAGTCAGG - Exonic
1167873689 19:52394133-52394155 AAGAAAAAGGTCAAAGAGGCCGG - Intergenic
1167880956 19:52456924-52456946 AAGAGGAAAGAAAAGGAGTCAGG + Exonic
1167888593 19:52522152-52522174 AAGAGGAAAGAAAAGGAGCCAGG + Intergenic
1167958349 19:53086278-53086300 AAGAGGAAAGAAAAGGAGTCAGG - Exonic
1167969923 19:53182900-53182922 AAGAGGAAGGCAAAGGAGTCAGG - Exonic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168164701 19:54538677-54538699 TAGAAGATGGACAATAAGGCTGG - Intronic
1168220873 19:54959431-54959453 TAGAAAAAAAACAAGGAGGCCGG - Intronic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168630259 19:57950626-57950648 AAGAAGCATGGGAAGGAGGCCGG - Intergenic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925328942 2:3043442-3043464 AAGAAGGAGGAAAAGGAGAGCGG + Intergenic
925481131 2:4275859-4275881 AATAAGAAGAACCTGGAGGCTGG + Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925613046 2:5719127-5719149 AAGAAGAAGGACAGTGAAGAAGG + Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925704699 2:6673367-6673389 AAGCAGAAGGAAAAGGAGAAGGG + Intergenic
925862241 2:8190475-8190497 AAGAAGAAGGAAAAGAATGAAGG - Intergenic
926233018 2:11019106-11019128 AGGAAGAAGAAAAAGGAGGTGGG - Intergenic
926366670 2:12139684-12139706 AAGAAGAAGGCCAGGGAGGATGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926574462 2:14564708-14564730 AAGAAGAAGAAACAGGAGGGAGG + Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
926910583 2:17849125-17849147 AGGGAGAAAGACAGGGAGGCAGG + Intergenic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927205454 2:20606617-20606639 AAGAAGAAGAAGAAAGACGCTGG - Intronic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
928230227 2:29492388-29492410 AAGAAGAGAGACAAGGATGAAGG + Intronic
928861297 2:35860484-35860506 AAGAAATAGCACAAGAAGGCAGG - Intergenic
928907229 2:36381082-36381104 AAGAAGGCGGGCAGGGAGGCTGG - Intronic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
928921838 2:36534711-36534733 AGGAAGAAGGAAAAGGAAGATGG + Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929034717 2:37679741-37679763 AAGAGGAAGGCACAGGAGGCTGG - Intronic
929137518 2:38638803-38638825 AAGAAGGAAGAAAAGGAGGTAGG + Intergenic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929694450 2:44102230-44102252 AATAAGAAGTACAAGTGGGCTGG + Intergenic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930989717 2:57638315-57638337 AAGATGAAGGAAAAGGAGGTAGG + Intergenic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931108372 2:59082931-59082953 AAGAACAGGGACAAGGTGGTAGG + Intergenic
931129519 2:59318465-59318487 AACAAGAAGAATAAGGAGGAGGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931201703 2:60103930-60103952 ATGAAGAAGGCCAGGGAGGGAGG - Intergenic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932135131 2:69222173-69222195 AAGGAGAATGACAAGAAGACAGG - Intronic
932169306 2:69539145-69539167 GAGAAGAAAGCCAAGGAGCCTGG + Intronic
932196562 2:69788885-69788907 AAGAAGGAGGAGAGGGAGGGAGG + Intronic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932600081 2:73117879-73117901 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
932672321 2:73748962-73748984 AAGAAAAAGAAAAAGGACGCTGG - Intergenic
932907517 2:75769472-75769494 AAACAGAAGGACTTGGAGGCTGG + Intergenic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
933230287 2:79799203-79799225 AAGAAGAGGGGGAATGAGGCTGG - Intronic
933261256 2:80134295-80134317 AAGAAGAGGGGCATGGAGGGAGG + Intronic
933652711 2:84862189-84862211 AGGAAGAAGGGCAAGGAGCCAGG - Intronic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
933726693 2:85431110-85431132 AAGGAGGAGGAAATGGAGGCTGG + Intronic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934652382 2:96099915-96099937 GGGAAGAAGGACAAAGAGGAGGG + Intergenic
934658428 2:96130033-96130055 AAGCAGAGGGAGAAGAAGGCAGG + Intronic
934914033 2:98283887-98283909 AAGGAGCTGGACTAGGAGGCAGG - Intronic
934927308 2:98390700-98390722 AAGCTGCAGGACAAGGAGGAGGG + Intronic
935241870 2:101185911-101185933 AAATATGAGGACAAGGAGGCTGG - Intronic
935305733 2:101734715-101734737 AAGAAGAAGCAACAGAAGGCAGG - Intronic
935458761 2:103302639-103302661 AAGAAGAAGAAGCAGAAGGCTGG - Intergenic
935647783 2:105355196-105355218 AAAAAGAAGGAAAAGAAGGAAGG + Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936538881 2:113334080-113334102 TAGGAGAAGGACAAGGGGTCAGG + Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937704929 2:124909634-124909656 AAGAAGAAAGAAAGGGAGGGAGG - Intronic
937709979 2:124969407-124969429 AGGAAGAAGGAAAATAAGGCAGG - Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938085457 2:128397133-128397155 AGGATGAAAGACAAGTAGGCTGG - Intergenic
938145587 2:128832499-128832521 AAGAAAAAAGAAAAGGAGGGAGG - Intergenic
938645759 2:133328467-133328489 AGGCAGAAGGAGAAGTAGGCTGG + Intronic
938709140 2:133960404-133960426 AAGAAAAAGAAAAAAGAGGCTGG - Intergenic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939623412 2:144447942-144447964 ATAAAGGAGGACATGGAGGCAGG - Intronic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940164050 2:150748370-150748392 AAGAAGGAGGAGAAGGACGAGGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940911906 2:159216639-159216661 AGGAGAAAGGACAACGAGGCGGG - Intronic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941483885 2:166054020-166054042 AAGAAGAAAGAAAAGGGGTCAGG + Intronic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
942043738 2:172087246-172087268 AAGAAGGAGGAGGAGGAGGGAGG - Intronic
942183338 2:173401720-173401742 AAGAAGAAGGGAAAGAAGGAAGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942431847 2:175920446-175920468 AAAAAAAAAGACAATGAGGCTGG + Intergenic
942466194 2:176209583-176209605 AAGAAGAGGAAAATGGAGGCCGG - Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942502572 2:176607094-176607116 AAGGAGAAGGAAGAGGAGGTGGG + Intergenic
942692255 2:178598512-178598534 AAGAAGAAGGAAAAGAAGAATGG - Exonic
942764003 2:179432432-179432454 TAGGAGAGGTACAAGGAGGCTGG - Intergenic
942909523 2:181226383-181226405 GAGAAGGTGGAAAAGGAGGCAGG - Intergenic
942977368 2:182034474-182034496 AAAAAGAAGGTCATTGAGGCTGG + Intronic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943690193 2:190861713-190861735 AAGAAGTAGGAAAAGGATGCTGG + Intergenic
943921538 2:193713269-193713291 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
944165682 2:196717593-196717615 AAGAAGCAGGATAAAGGGGCGGG + Intronic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
944395750 2:199264071-199264093 AGGAAGAAGGAACAGGAGGAAGG + Intergenic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945898963 2:215516762-215516784 AGGAAGGAGGACAAGGAAGGGGG + Intergenic
945915110 2:215695561-215695583 AAGAAGACTGATAAAGAGGCAGG + Intergenic
946054306 2:216887499-216887521 AAGAAGAAAGCCAAGCAAGCAGG - Intergenic
946060141 2:216934440-216934462 AAGAAGAAAGAAAGGGAAGCAGG - Intergenic
946080029 2:217109893-217109915 AAGGAGAATGAAGAGGAGGCTGG + Intergenic
946243267 2:218369780-218369802 AAGAAAAAGGAAATTGAGGCTGG - Intergenic
946314536 2:218901592-218901614 AAAAAGAAAGACCAGCAGGCAGG + Intergenic
946321438 2:218956857-218956879 ATGAAGACAGACAAGGAGACTGG + Intergenic
946334947 2:219030219-219030241 AAGCAGAAGGACAAAGGGTCAGG + Intronic
946419351 2:219556302-219556324 AAGAAGGAGGCCATGGAGTCTGG + Intronic
946447875 2:219755082-219755104 GAGAAGAAGGACTAGTAGGGAGG - Intergenic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946693304 2:222326326-222326348 AAGATGCAGGTCTAGGAGGCTGG + Intergenic
947452857 2:230224399-230224421 AACAAGAAGGAAAAGTATGCTGG - Intronic
947543344 2:230993438-230993460 AAGAAGAAGAAGAAGAAGGTGGG + Intergenic
947627718 2:231631014-231631036 AAGAAGAAGCAAAAGTTGGCCGG + Intergenic
947629371 2:231642003-231642025 AAGAAGAATGAGAAGGCTGCCGG - Intergenic
947898268 2:233695418-233695440 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948209595 2:236183052-236183074 AAGGAGGAAGACAAGGAGGAGGG - Intergenic
948236122 2:236391968-236391990 AAGAAAAAGGACAAGGTGAGTGG - Exonic
948276027 2:236709505-236709527 GAGAAATAGGACAAGGTGGCTGG + Intergenic
948348282 2:237317565-237317587 ATGAAGAGGGACAGGGAGTCAGG - Intergenic
948382161 2:237558392-237558414 AGGAAGAAAGACTAGGAGGGAGG + Intergenic
948493407 2:238329028-238329050 AAGGAGAAGGCCAAGGAGAATGG + Exonic
948498906 2:238376438-238376460 AAGAAGAGGCATAAGGCGGCAGG - Intronic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948745384 2:240089099-240089121 AAGAGGAAAGCCACGGAGGCTGG - Intergenic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
949060686 2:241955323-241955345 AACAAGCAGGACAGAGAGGCAGG + Intergenic
1168752340 20:291695-291717 AAGGAGACTGAAAAGGAGGCAGG - Intergenic
1168846195 20:946258-946280 AACAAGAGAGGCAAGGAGGCTGG - Intergenic
1168863580 20:1064278-1064300 AAGAGGAAGAAAAAGGAGGGAGG + Intergenic
1168878261 20:1185554-1185576 AAGGAGAGGGACAGGAAGGCGGG + Intronic
1169052960 20:2595960-2595982 AAGGAAAAGAACAAGGAGACAGG + Intronic
1169118014 20:3079087-3079109 AAGAACAAGTAATAGGAGGCTGG - Intergenic
1169163121 20:3399502-3399524 ACTAAGAAAGAAAAGGAGGCCGG - Intronic
1169541650 20:6606333-6606355 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1170466294 20:16625468-16625490 AAAAAGAAAGACAGGGAGGGAGG - Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170779611 20:19412542-19412564 AGGAAGACGGAGAAGGAGGAGGG + Intronic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1171059906 20:21946078-21946100 AAAGAGAAGGACCAGAAGGCAGG + Intergenic
1171100786 20:22381938-22381960 AGGCAAAAGGACGAGGAGGCTGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172038694 20:32028779-32028801 AGGAAGAAGGAGAAGGGGGGTGG + Intronic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172126685 20:32628727-32628749 AAGGAGGGGGACAAGGTGGCGGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172545147 20:35754939-35754961 AAGAAGAAGAAGAAGAAAGCAGG - Intergenic
1172569864 20:35961582-35961604 AAAAAGCAGGAGAGGGAGGCAGG - Intronic
1172761607 20:37327354-37327376 CAGAAGAAGGCCAAAGAAGCTGG - Intergenic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1172928640 20:38564908-38564930 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173029137 20:39338531-39338553 AAGAAGAAAGACACAGAGGCTGG + Intergenic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173381914 20:42552806-42552828 AAGAAGAAATACAAGTAGCCAGG + Intronic
1173530650 20:43766865-43766887 ATGAACAAAGACAGGGAGGCTGG - Intergenic
1173546987 20:43905175-43905197 AGGAAGGAAGACAAGGAGGAAGG + Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173858323 20:46265775-46265797 AAGAAGAAGAAAAAGGAGAATGG - Intronic
1173873510 20:46356148-46356170 AAGTAGGAGGACAAGAAGGCAGG + Intronic
1174012974 20:47465505-47465527 AACAAGAAGACCAGGGAGGCCGG - Intergenic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174404084 20:50292590-50292612 AAGAGGCAGGAGATGGAGGCTGG - Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174602523 20:51736226-51736248 AAGATAAAGGACAAGGAGGGAGG + Intronic
1175047617 20:56122203-56122225 AAGCTGGAGCACAAGGAGGCTGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175499785 20:59441631-59441653 ATGGAGAATGACAAGGAGGGAGG + Intergenic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176049494 20:63110194-63110216 AAGATGAAGGAGGAGCAGGCAGG + Intergenic
1176551621 21:8225282-8225304 AAGAAGAAAGGCAGGAAGGCAGG - Intergenic
1176570530 21:8408281-8408303 AAGAAGAAAGGCAGGAAGGCAGG - Intergenic
1176578439 21:8452448-8452470 AAGAAGAAAGGCAGGAAGGCAGG - Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177114863 21:17073343-17073365 AAGAAGAAGGGGAAGGAGAAGGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177343332 21:19834643-19834665 AAGAAAAAGGACAAAGAAGGAGG - Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177538420 21:22460080-22460102 AGGAAAAAGGAAAAGGAAGCAGG + Intergenic
1177609653 21:23430607-23430629 AAGAAGAAGGACAAGACAGAAGG - Intergenic
1178143464 21:29710880-29710902 AAGAAGAAAGGGAAGGAGGGTGG - Intronic
1178349881 21:31865018-31865040 AAGAAGAAGGAGGAGGAGAAGGG - Intergenic
1178424927 21:32471620-32471642 AAAAAAAAGGAAATGGAGGCTGG - Intronic
1178630797 21:34259739-34259761 AAAAGGAAGAACAAGGAGTCAGG - Intergenic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1178996485 21:37405341-37405363 AAGAATTAGGAAAAGGATGCAGG - Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179081846 21:38178669-38178691 AAGAAGAAGGAAGAAGAGGAAGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179336747 21:40463769-40463791 AAGAAGGATGCCAAAGAGGCTGG - Intronic
1179423369 21:41253606-41253628 AAGAAGCAGGAGGAGAAGGCAGG + Intronic
1179547745 21:42124081-42124103 AAGAAGCAGGACCTGGAGCCAGG - Intronic
1179585030 21:42369371-42369393 AGGAAGCAGGAAAAGGTGGCGGG + Intergenic
1180758500 22:18180623-18180645 AAGAAGAAAGGCCAGGAGGGTGG - Intergenic
1180777525 22:18497980-18498002 AAGAAGAAAGGCCAGGAGGGTGG + Intergenic
1180826662 22:18867639-18867661 AAGAAGAAAGGCCAGGAGGGTGG - Intergenic
1180960731 22:19761174-19761196 AAGAAGAACGCGAAGGTGGCCGG + Exonic
1181196389 22:21189542-21189564 AAGAAGAAAGGCCAGGAGGGTGG + Intergenic
1181325275 22:22040119-22040141 GACAAGATGGACAAGGAGGTGGG + Intergenic
1181359621 22:22324366-22324388 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181369693 22:22406104-22406126 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181469662 22:23130157-23130179 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1181967396 22:26666747-26666769 AGAAAGAAGGACCAGGAGCCAGG - Intergenic
1181977211 22:26738473-26738495 AAGGAGGAGAACAAGGAGGAGGG - Intergenic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182663685 22:31942869-31942891 AAGAGGAAGGCCTGGGAGGCAGG + Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182966204 22:34523495-34523517 AAGAAGAAGGCCAGTGTGGCTGG - Intergenic
1182997357 22:34826465-34826487 AAGCAGAAAAAAAAGGAGGCTGG + Intergenic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183326245 22:37196298-37196320 AACAAGAAGGAAACTGAGGCAGG - Intronic
1183389003 22:37533135-37533157 AAGAAAAAAGAAAAGAAGGCGGG + Intergenic
1184014219 22:41773577-41773599 AAAAAGAACAGCAAGGAGGCCGG + Intronic
1184237718 22:43193559-43193581 AAAAAAATGGACAAAGAGGCTGG - Intergenic
1184538778 22:45106177-45106199 AAGCAAAAGGACTGGGAGGCGGG + Intergenic
1184627813 22:45751225-45751247 TAAAAGAAGAACAAAGAGGCTGG - Intronic
1184676180 22:46044706-46044728 AAGAAGGAGGAAAAGCAGGCCGG - Intergenic
1184723725 22:46331099-46331121 AAGAGGATGGGCGAGGAGGCCGG + Intronic
1184749135 22:46474209-46474231 GACAAGGAGGACTAGGAGGCTGG - Intronic
1184954913 22:47879530-47879552 AAAAATAAGGCCAAGGGGGCAGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1203230409 22_KI270731v1_random:105299-105321 AAGAAGAAAGGCCAGGAGGGTGG - Intergenic
1203256643 22_KI270733v1_random:142202-142224 AAGAAGAAAGGCAGGAAGGCAGG - Intergenic
949137777 3:590254-590276 AAGAAGAAGGCCAATAAGTCTGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
949449131 3:4166106-4166128 AAGAGGAAAGACAAGGGTGCAGG - Intronic
949763868 3:7504289-7504311 AAGAAGAAGTACAAAGAAGCAGG - Intronic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
949856951 3:8470544-8470566 AATAAGAAAGACAATGAGGATGG + Intergenic
949901829 3:8821509-8821531 AGGAAGAAGGCCAGGAAGGCAGG - Intronic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950071779 3:10158444-10158466 AAAAAAAAAGAAAAGGAGGCCGG - Intergenic
950080195 3:10216460-10216482 AAGAGGAAGGCAAAGGAGGAGGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950403923 3:12792763-12792785 AAGAAAAAAGAAAAAGAGGCTGG - Intergenic
950471117 3:13186988-13187010 AAGAAGGAAGAAAAGGCGGCAGG - Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
951703197 3:25516921-25516943 AATAAAAGGGACAAGGAAGCTGG - Intronic
951738078 3:25889747-25889769 AAGAAGGAAGAAAAGAAGGCAGG - Intergenic
952046488 3:29327486-29327508 AAGGAGGAGGAAAAGGAGGAAGG - Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952165175 3:30740117-30740139 AAGAAGAAAGCAAAGCAGGCAGG + Intronic
952288260 3:31989104-31989126 AAGAGGAAAGAAAAGGAGCCAGG + Exonic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952710214 3:36423867-36423889 AAGAAGAAAGATGAGGAGGAAGG - Intronic
952751985 3:36832081-36832103 AGCAAGAAGGACAAGGAGCTTGG - Exonic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953230240 3:41058300-41058322 AAGAAGGAGGAGGAGGAGGGAGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953423380 3:42772513-42772535 AAGAAGAAAGAGAAGGAGAGGGG - Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954182254 3:48890638-48890660 AAAAAAAAAGACAAGGGGGCAGG - Intronic
954535809 3:51358488-51358510 ATGAAGAAGGACAGGGAGAGAGG - Intronic
954610746 3:51943401-51943423 AAGAAGAAGGGCCGGCAGGCAGG + Exonic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955407016 3:58631874-58631896 AAGAAGACAGACCAGGAAGCTGG - Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955643864 3:61115402-61115424 AAGGCCAAGCACAAGGAGGCTGG + Intronic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956627493 3:71281066-71281088 AAGAAGAAGAAAAAGTAGCCAGG + Intronic
957125772 3:76158250-76158272 AGAAAGAAAGTCAAGGAGGCAGG - Intronic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957824552 3:85423399-85423421 AGGCAGAAGGACAAGGACTCTGG - Intronic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
957885005 3:86275488-86275510 AAGAACTAAGAAAAGGAGGCAGG - Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958111983 3:89159940-89159962 AGGAAGAAGGAAAAGAAGGAAGG - Intronic
958415554 3:93869034-93869056 AAAAAGAAGGATAGGGAGGTAGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959445732 3:106436356-106436378 AAGAAGAGAGAGAAGGAGGGAGG + Intergenic
959619771 3:108387220-108387242 AACCACCAGGACAAGGAGGCAGG - Intronic
959928975 3:111958159-111958181 AAAAAGGATGACAAGGGGGCAGG - Intronic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960023871 3:112987194-112987216 AAGTACAAGGACACAGAGGCAGG + Intergenic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960680169 3:120239391-120239413 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
961156749 3:124686082-124686104 AAGAAGCATAAGAAGGAGGCAGG + Intronic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962039035 3:131685485-131685507 ATTAAGAAGTAAAAGGAGGCTGG + Intronic
962042249 3:131719548-131719570 AAAAAGAAGGACAGGCTGGCTGG - Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962728395 3:138256704-138256726 AACAAGAAGGAAAAAAAGGCCGG - Intronic
962758964 3:138491734-138491756 TAAAAGAAAGACAGGGAGGCAGG - Intergenic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
962878712 3:139555898-139555920 AAGGAGAAGGGCAGGGAGGTAGG + Intergenic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963111235 3:141689839-141689861 AAGAAGAAGCAACACGAGGCTGG + Intergenic
963349285 3:144132987-144133009 ATGAACAAAGAAAAGGAGGCTGG - Intergenic
963559906 3:146851307-146851329 AAGATGAAGGAAAAGGAGAAAGG + Intergenic
963594141 3:147303907-147303929 AAGAAGAAGAACAAGAAATCAGG + Intergenic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963931462 3:151008340-151008362 AAGAACAAAGTCAAGGAGGCAGG - Intergenic
964108105 3:153060453-153060475 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964258671 3:154809087-154809109 AGGAAGAAAGACAGGGAGGGAGG - Intergenic
964328685 3:155575984-155576006 AGGAAGAAGGAAGAGAAGGCAGG - Intronic
964374400 3:156035405-156035427 AAGAAGGAGGAGGAGGAGGGAGG - Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964564316 3:158033112-158033134 AAGAAGAAGAAAAAGAAGGGTGG + Intergenic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965380450 3:167981678-167981700 AAGAAGAAGAAGAGGGAGACAGG - Intergenic
965608273 3:170518401-170518423 TAGATGAGGGACAAGGAGGGAGG - Intronic
965823726 3:172710234-172710256 AAGAAAGAGGACTGGGAGGCTGG - Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966026214 3:175286288-175286310 AAAAAGGAGGAGGAGGAGGCTGG + Intronic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966211976 3:177462981-177463003 AAGAAGAGGGAAAAGGGTGCTGG + Intergenic
966377579 3:179312631-179312653 AAGAAGAAGAATAAAGATGCAGG - Intergenic
966428064 3:179802236-179802258 AAGAAAAAAGAAAAGCAGGCTGG + Intronic
966521900 3:180882344-180882366 AAGAAGAAGGAGACGGAAGAAGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966592348 3:181696532-181696554 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966852010 3:184170363-184170385 AAGGAGAAGGACCCGAAGGCCGG + Exonic
966856178 3:184195361-184195383 AGGAAGGATGCCAAGGAGGCAGG - Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
966963289 3:184963109-184963131 AAGAAAAAGAATAAGGAGGGAGG - Intronic
967313699 3:188130716-188130738 AAGAAGGAGGAGAAGGAGAAGGG + Intergenic
967336687 3:188352045-188352067 AAGAAAAATGACAAGGGGGGAGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967390724 3:188951460-188951482 AAGAAGAAGAACATGGAGACTGG + Intronic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
967987684 3:195107510-195107532 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
968123659 3:196143297-196143319 GAGAAGGAGGGCAACGAGGCCGG + Intergenic
968544994 4:1193964-1193986 AAGAAGAGGGACAGGGAGCAGGG - Intronic
968610683 4:1555592-1555614 AAGGACAGGGACAGGGAGGCCGG - Intergenic
969402001 4:6961839-6961861 AGGCAGGAGGACAAGGAGGCTGG + Intronic
969405660 4:6989791-6989813 AAGAAAAAAGGCAGGGAGGCAGG - Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969509989 4:7612298-7612320 AAGGAGAAGGGCATGGAGACAGG + Intronic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
969954804 4:10877995-10878017 AAGGAGGAGGAAAAGGAGGAAGG - Intergenic
969955206 4:10882414-10882436 AAGAAGAAGAAAAAGGAAGAGGG - Intergenic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
971166778 4:24191667-24191689 AAAAAGAAGGAAAAGGAGAAAGG + Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971317893 4:25582608-25582630 ATGAAGAAGGAAAAGAAGACGGG - Intergenic
971386481 4:26145011-26145033 AAAAAGAAGAAGAAGAAGGCAGG - Intergenic
971420268 4:26467987-26468009 AAGAAGAAGAAGAAGAAAGCGGG + Intergenic
971483411 4:27134705-27134727 AAAGACAAAGACAAGGAGGCCGG + Intergenic
972082531 4:35171657-35171679 AAGCAGAAGGGCAAGGGAGCCGG - Intergenic
972422591 4:38903458-38903480 AAAAATGAGGTCAAGGAGGCTGG - Intronic
972663566 4:41142084-41142106 AAGATGGAGGAAAAGGATGCTGG + Intronic
973120460 4:46515502-46515524 AAGAGGAAGGAAAAGCAGACTGG - Intergenic
973280042 4:48350354-48350376 TAGCAGAAGGGTAAGGAGGCAGG - Intronic
973299154 4:48560432-48560454 AGGAAGAATGACAAGGTGGTGGG + Intronic
973955053 4:56055237-56055259 AAGAAGGAAGATAAGGAGACAGG + Intergenic
974803602 4:66851621-66851643 AAGTAAAAGGCCAAGGATGCAGG + Intergenic
975228470 4:71902948-71902970 AAAAAGAAGGAAATGAAGGCAGG - Intergenic
975735549 4:77377431-77377453 GAAAAGAAGGACAAGGACGCTGG - Intronic
975739282 4:77413076-77413098 AGGAAGGAGGACAAGGATGCTGG - Intronic
976128558 4:81858984-81859006 AAGAAGAAAGAACAGGAGGTAGG + Intronic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
976767294 4:88610598-88610620 GAGAAGACAGACAAGGAGGGTGG - Intronic
976849643 4:89530304-89530326 AATAAGAAGGTCTAGGAGGCAGG + Intergenic
976951950 4:90844445-90844467 AATAAGAAGGCCAATGTGGCTGG - Intronic
977126334 4:93173429-93173451 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
977318240 4:95478308-95478330 AAGAATAAGGACAAGGATTGGGG + Intronic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
978005679 4:103613211-103613233 AAAAAGAAGGACTAAGAGCCAGG + Intronic
978189856 4:105898144-105898166 AAGAAGCAGAATAAGGAGTCTGG - Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978637917 4:110832905-110832927 GAGAAGAAGAAAGAGGAGGCAGG + Intergenic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979497841 4:121404671-121404693 AGGAAGCAAGACAAGGAGGAGGG + Intergenic
979609447 4:122673732-122673754 AAAAAGAAGGACACAGTGGCAGG + Intergenic
979646228 4:123073214-123073236 AAGAAGAAAGAAAAGGAGATAGG - Intronic
979670719 4:123357546-123357568 AGGAAGAAGGAAAAGCAGGAGGG - Intergenic
979938714 4:126731838-126731860 AAGAAGAAAAAAAAAGAGGCTGG + Intergenic
979979534 4:127237553-127237575 AAAAAGAAAGAAAAGGAGGGAGG + Intergenic
980137518 4:128873029-128873051 AAGAAGAAGGTCAAGTGGACTGG - Exonic
980425672 4:132624654-132624676 AAGAAGAAGGAAAAAGAAGGAGG - Intergenic
980578048 4:134711201-134711223 AAGAACTAGGAAAAGAAGGCAGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980838271 4:138224785-138224807 AGGAAGAAGGAAAAGAAGGAAGG + Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981052834 4:140328052-140328074 AAGCAGAAGCACGAGGAGTCTGG - Intronic
981379479 4:144056498-144056520 AAGGAGAAGGAAAAGGAAGTTGG + Intergenic
981653083 4:147081078-147081100 AAGTAGAGGGATGAGGAGGCTGG - Intergenic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
981936695 4:150247060-150247082 AAGAAGAAGGGAAAGGAGATCGG + Intronic
981985406 4:150848469-150848491 ACTAGGAAGGATAAGGAGGCGGG + Intronic
982055559 4:151545671-151545693 ACTAAGAAGGATAAGGAGGCTGG - Intronic
982068890 4:151677931-151677953 AGGAAGAAGGAGGAGGAGGGAGG - Intronic
982464265 4:155710695-155710717 AAGAAGCAGGAAAAAGGGGCAGG + Exonic
982986922 4:162221574-162221596 AAGAATGAGGACACGGATGCTGG + Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983105424 4:163680609-163680631 AGGAAGGATGACAAGGAGCCTGG - Intronic
983203160 4:164884205-164884227 AAGAAGAAAGAAAAAGAGGAAGG + Intronic
983211404 4:164962138-164962160 AAGAAGGAGGATAAGGAAGGAGG + Intronic
983611794 4:169654238-169654260 AGGAAGAAGGGAAAGGAGGAGGG - Intronic
983820311 4:172184809-172184831 AGGTAGAAGGACAAGGGGGCTGG + Intronic
983906348 4:173186537-173186559 AAGAAGAAGGAACAGAAGGAAGG - Intronic
984330578 4:178310432-178310454 AAGAAGGAGGACACTGAGGAAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984725162 4:183013450-183013472 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
984834179 4:184003889-184003911 AAGAAGAAAGGAAAGAAGGCAGG - Intronic
984850123 4:184145304-184145326 AGGAAGAAAGAAAAGGAGGCAGG - Intronic
984908780 4:184652849-184652871 AAGAAAAAAGAAAAGGAGGGAGG + Intronic
985006579 4:185540488-185540510 AGGAAGAAAGAAAAGGAGGTAGG - Intergenic
985117490 4:186605759-186605781 AAGAGGAAGGTCAAGGGGGGAGG + Intronic
985196286 4:187433263-187433285 AAGGAGAAGAACAAGAGGGCTGG - Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
985648509 5:1096620-1096642 AAGATGAAGGACCAGGAGCCTGG + Intronic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985958433 5:3281748-3281770 GGGAAGAAGGAAAAGGAAGCAGG + Intergenic
986026212 5:3853792-3853814 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986248050 5:6029019-6029041 AACAAAAAGCAAAAGGAGGCTGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986731944 5:10641205-10641227 AAGAAGAAGAAGAAGAAGACTGG - Intronic
986854925 5:11857376-11857398 AACAAAAATGACAATGAGGCTGG + Intronic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988614641 5:32763608-32763630 AAAAAGATGGCCAAAGAGGCTGG - Intronic
988632071 5:32942294-32942316 AAGAAGAAGGAGGAGGACGAGGG + Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988857499 5:35243197-35243219 AAAAAGAAGGCAAAGTAGGCTGG + Intergenic
989077978 5:37585284-37585306 TAAAAAATGGACAAGGAGGCTGG - Intronic
989233913 5:39122077-39122099 AAGAAGCAGAACCAGGAGGATGG + Intronic
989278008 5:39610974-39610996 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
989315127 5:40069664-40069686 ACAAAGAAGGCCAAGGTGGCTGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990379499 5:55207993-55208015 AAAAAGAAGGAAGAGGAGGTGGG + Intergenic
990425401 5:55683030-55683052 AAGAAGAGAGGGAAGGAGGCAGG + Intronic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991272138 5:64796764-64796786 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991272151 5:64796808-64796830 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991354217 5:65750775-65750797 AAGAAGAAAGAAAAGAAGGAAGG + Intronic
991435685 5:66595976-66595998 AAGAAAACGGACAAGAAGGAGGG - Intergenic
991492939 5:67200963-67200985 AAGCAGCATGACAAGAAGGCAGG - Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992297920 5:75344897-75344919 AACATTAAGGACATGGAGGCCGG - Intronic
992954522 5:81893521-81893543 AAAAGGAAGGGAAAGGAGGCTGG + Intergenic
993037485 5:82773651-82773673 AAGAGATAGGACAAGGAGTCAGG - Intergenic
993302277 5:86225956-86225978 AAGTAGGGGGATAAGGAGGCAGG + Intergenic
993387379 5:87275862-87275884 ATGAAGAAGGCCAAGCTGGCTGG - Intronic
994793717 5:104265884-104265906 AAGAAGGAGGAAAAGCAGGAAGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995442332 5:112205821-112205843 AATAAGAAAGCCAAGGAGGAAGG + Intronic
995644766 5:114299094-114299116 AGGAAGAAAGAAAAGGAGGGAGG - Intergenic
996009987 5:118471675-118471697 ATAAAAAAGGTCAAGGAGGCTGG + Intergenic
996517718 5:124391763-124391785 AAAAAGAAGGAAAATCAGGCCGG + Intergenic
996533078 5:124546560-124546582 AAGAAAAAAGACAAGGATGAGGG + Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
996903799 5:128575053-128575075 AAAAAGCATGACAAGGAGCCTGG + Intronic
996946155 5:129070692-129070714 AAAAAGAACAACAAAGAGGCAGG - Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
998051808 5:139042183-139042205 AAGGACAAGGACAAGGATTCCGG + Intronic
998078906 5:139258568-139258590 ATGAGGAAGGACAGGTAGGCAGG + Intronic
998215837 5:140238155-140238177 AAGCTGCAGGAAAAGGAGGCAGG + Intronic
998225960 5:140326412-140326434 AAGAAGCAAGACAAGGAGCTGGG - Intergenic
998800768 5:145866564-145866586 AAGAAGAAAGCTATGGAGGCAGG - Exonic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
999089308 5:148921372-148921394 GAGAAGGAGGAAAAGGAGGATGG + Intergenic
999154071 5:149445618-149445640 AAGAAGGAGGAGAAGGAGTGGGG + Intergenic
999655594 5:153807576-153807598 GGGAAGAAGGCCAAGGAGACTGG + Intronic
1000202875 5:159028890-159028912 CAGAAGAAGGCCAGTGAGGCTGG + Intronic
1000209815 5:159098684-159098706 AAGAAGAAAGAAAAGAAGGCAGG + Intronic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1000899069 5:166891220-166891242 AATAAAAAGGAAAACGAGGCCGG + Intergenic
1000931363 5:167255528-167255550 AACAAGAAGGAAAAGAGGGCAGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001049212 5:168400877-168400899 AAGAAGAAAGAAAGGGAGGGAGG + Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001332641 5:170773112-170773134 AGGAAGAGGGACAGGCAGGCAGG + Intronic
1001511080 5:172322409-172322431 AGGAAGGAGGAAAAGGAGGGAGG - Intergenic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1001919452 5:175588783-175588805 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1001944923 5:175770862-175770884 AGCAGGGAGGACAAGGAGGCAGG + Intergenic
1002260832 5:177992950-177992972 AAGAAGCTGGAAAAGGCGGCAGG + Exonic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003337159 6:5185045-5185067 AAGACAAAGGGCAAGGAGGAAGG - Intronic
1003382875 6:5640822-5640844 AAGAAAAGGGACAAGGAGTGGGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003651756 6:7967313-7967335 CAGAAGGAGGACAAGCAGGTTGG + Intronic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1003777885 6:9389882-9389904 GAGAAGATGAAAAAGGAGGCAGG + Intergenic
1003893843 6:10588132-10588154 AAGAGGATGGGCAAGGTGGCTGG + Intronic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004375802 6:15089832-15089854 AAGCAGAAGGACAGGGTGGCAGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004453263 6:15767247-15767269 AGGAAGAAGGCCATGGAGGATGG + Intergenic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1004569932 6:16835237-16835259 AAAAAAAAAGAAAAGGAGGCTGG - Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005011498 6:21340165-21340187 AAGAAGAAGCACATGGAAGAGGG - Intergenic
1005088499 6:22032073-22032095 AAAAAGAAGAAGAAGGAAGCGGG - Intergenic
1005290108 6:24371305-24371327 AAAAAAAAGAACTAGGAGGCTGG + Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005422554 6:25667667-25667689 AAGAAGAAGGAACAGGATGAAGG - Intronic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005670930 6:28105367-28105389 AAGATAAAGGACATGGAAGCGGG - Intergenic
1005950029 6:30625116-30625138 AAGACAAAGAACAAGGAGACAGG - Intronic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006098818 6:31672967-31672989 AGCAAGAAGGACGAGGAGGCCGG + Exonic
1006179149 6:32143559-32143581 AAGAAAAAAGAAAAAGAGGCTGG + Intergenic
1006251467 6:32790624-32790646 AATAAGAAGGCCAGTGAGGCTGG + Intergenic
1006716862 6:36126007-36126029 AAGCAAAATTACAAGGAGGCAGG - Intergenic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1006990962 6:38214390-38214412 AAGAAGGTGGACAATGAGACAGG + Intronic
1007209089 6:40177273-40177295 AAGACGAAGGAAGAGCAGGCAGG + Intergenic
1007309506 6:40934382-40934404 AAGAAGAAAGGCAGGCAGGCTGG - Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007512171 6:42381896-42381918 AAGAGGAGGGGCAAGAAGGCTGG + Intronic
1007835996 6:44674192-44674214 AAGAAGGAGTAGATGGAGGCTGG + Intergenic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008586460 6:52955062-52955084 AAGAGTAAGTACAAGGTGGCCGG + Intergenic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009512392 6:64569444-64569466 AAAAAGAATGAAAAGGAGCCGGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010082955 6:71886100-71886122 AATAAGAAAGACACGGTGGCAGG + Intergenic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010311383 6:74389880-74389902 AAGAAGAAGGAAGAAGAGGAAGG - Intergenic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010703848 6:79083937-79083959 AGGAAGGAAGACAGGGAGGCAGG - Intergenic
1010743692 6:79537204-79537226 AAGAGGGAAGGCAAGGAGGCGGG - Exonic
1010951547 6:82042662-82042684 AAGAAGCAGGTAGAGGAGGCTGG - Intergenic
1011092201 6:83616212-83616234 ACAAAGCAGGACAAGGAGGATGG + Intronic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011534442 6:88360817-88360839 AAAAAGGAGGGAAAGGAGGCAGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1011910217 6:92426448-92426470 AAAAAAAAATACAAGGAGGCCGG - Intergenic
1012146983 6:95696792-95696814 AAGAAGGAAGTCAAGGGGGCTGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1012734208 6:102918108-102918130 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1012990662 6:105922586-105922608 AAGAAGGAGGAAGAGGAGGAAGG + Intergenic
1013093406 6:106921605-106921627 AAGAAGAAGGAAAAGGAAAAGGG + Intergenic
1013199706 6:107881504-107881526 AATAAAAAGCACAAGGAGGGAGG - Intronic
1013390798 6:109684576-109684598 AAAAAGTAGGCAAAGGAGGCCGG + Intronic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1013793669 6:113860376-113860398 GAGAAAAAGGCCGAGGAGGCCGG + Exonic
1014207567 6:118672782-118672804 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
1014233008 6:118925047-118925069 AAAAAGAAAGACAGGGAGGGAGG + Intronic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014758805 6:125331841-125331863 AAGAAGAAAGAAAAGGAGGAGGG - Intergenic
1014794983 6:125714555-125714577 AAGTGAAAGGACAAGAAGGCAGG - Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015645251 6:135380035-135380057 AAGAAGAAAGAGAGGGAGGGAGG - Intronic
1016093374 6:140006413-140006435 ATGATACAGGACAAGGAGGCAGG - Intergenic
1016239205 6:141908706-141908728 ATAAAGAAGGACCAGCAGGCAGG + Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016710142 6:147161693-147161715 AGGAAGAAAGAAAAGGAGGAGGG - Intergenic
1016737980 6:147501093-147501115 AAAAAGAATGACCAGGAGACTGG + Intergenic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016801476 6:148173513-148173535 AAGAAGAAGGGGAAGAAGGGGGG + Intergenic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339640 6:153305453-153305475 AAGAAGAAGGAGGAGGAGTAGGG - Intergenic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1017997576 6:159546160-159546182 AAGAAGAGGGCCATGGAGACTGG - Intergenic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018043900 6:159949466-159949488 AAAATGAAAGACAGGGAGGCTGG - Intergenic
1018048093 6:159982205-159982227 AGGAAGAGGAGCAAGGAGGCAGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018445547 6:163854933-163854955 AAGAAGGAAGAAAAGGAGGAGGG + Intergenic
1018477096 6:164153703-164153725 TAGCAGGAAGACAAGGAGGCGGG - Intergenic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018609956 6:165638358-165638380 AAGAGGAAGGACGAGAAGGAAGG + Intronic
1018765781 6:166931913-166931935 AAGAAGGAGGCCAAGGAGATGGG - Intronic
1018875842 6:167821744-167821766 GGAAAGGAGGACAAGGAGGCAGG + Intergenic
1019133033 6:169891154-169891176 AAGATGAAGGACAAGGAGGGTGG + Intergenic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1019636437 7:2078553-2078575 AAGAAGAAAGCAGAGGAGGCTGG + Intronic
1019697281 7:2452634-2452656 AAGAAGAAGGAAAAGAAAGAAGG - Intergenic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1020005047 7:4778491-4778513 AAGAAACAGGACATGGAGTCTGG + Intronic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020140534 7:5609142-5609164 AAAAAAAAGGAAAAAGAGGCCGG + Intergenic
1020179262 7:5908724-5908746 AAGGAGACAGACAATGAGGCTGG - Intronic
1020303672 7:6816131-6816153 AAGGAGACAGACAATGAGGCTGG + Intronic
1020314453 7:6895119-6895141 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1020390500 7:7652595-7652617 GAGAAGTAGGATAAAGAGGCAGG + Intronic
1020423229 7:8034723-8034745 AAAAAGAAGGAAAAAGAGGCTGG + Intronic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1021099843 7:16575117-16575139 AAAAAGAAAGAAAAGGAGGGAGG + Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021289380 7:18823989-18824011 AAGAAGAAGGAGAAGGGGAATGG + Intronic
1021464913 7:20931485-20931507 AAGATGAAAGAAAGGGAGGCAGG - Intergenic
1021468146 7:20969169-20969191 AAGAAGAAAGAAAGGGAGGGAGG + Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021796946 7:24265354-24265376 AAGAAGCAGGAGAAGCAAGCAGG + Intergenic
1021986818 7:26105340-26105362 AAGAAGGAGGATGAGGAAGCTGG - Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022094306 7:27129591-27129613 AAATAGAAGGCCAAGGAGGAGGG + Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022384743 7:29890582-29890604 AAGAAGACGGGCAAAGAGCCTGG - Intronic
1022417677 7:30191948-30191970 TAGAGGAAAGACAAGGGGGCGGG + Intergenic
1022477431 7:30720725-30720747 GAGAAGAAGGACAAGCAGAAGGG - Intronic
1022845786 7:34208450-34208472 GAGAAGAAGGAAAAGAAGGTAGG - Intergenic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023095309 7:36654308-36654330 AAGAAGAAGAAAAAGGAGAGAGG - Intronic
1023187543 7:37547871-37547893 AAAAAAAAGGAAGAGGAGGCAGG + Intergenic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023338295 7:39192934-39192956 GAGAGGAAGGACAAGGAGAAAGG + Intronic
1023344599 7:39258716-39258738 AAGAAGAAGAAGAAGGTGGTAGG + Intronic
1023478425 7:40606165-40606187 AAGAAGAAGGACAAAGAGAGTGG + Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023613581 7:41995758-41995780 AAGAAGAAAGGCAAGAAGGGAGG + Intronic
1023641312 7:42261917-42261939 AAGAAGAAAGAAAAGGAAGAAGG - Intergenic
1023693434 7:42818642-42818664 AGGAAGAAGGAGAAGGAAGGAGG + Intergenic
1023808663 7:43893572-43893594 AAGTAAAAGGACAAAAAGGCTGG + Intronic
1024033375 7:45484112-45484134 AGGAAAGAGGAAAAGGAGGCAGG + Intergenic
1024222106 7:47297183-47297205 ATGTTGAAGGACAAGGAGCCGGG - Exonic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024525231 7:50343007-50343029 AAGAAGAAAGACAGGAAGGAAGG - Intronic
1024525813 7:50348320-50348342 AGGAAGAAGGAGAAGGAGAGGGG + Intronic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1024919304 7:54541706-54541728 AAGATGAAGGAAAAGAAGGCAGG + Intergenic
1025057917 7:55779961-55779983 AAGAAGATGAAAAATGAGGCTGG - Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025840692 7:65143108-65143130 AAGAAAAATGGCAAGCAGGCAGG - Intergenic
1025878019 7:65507055-65507077 AAGAAAAATGGCAAGCAGGCAGG + Intergenic
1025882356 7:65552849-65552871 AAGAAAAATGGCAAGCAGGCAGG + Intergenic
1025891086 7:65649753-65649775 AAGAAAAATGGCAAGCAGGCAGG - Intergenic
1026027951 7:66762292-66762314 TAGAAATAGGACATGGAGGCTGG + Intronic
1026027996 7:66762616-66762638 AAGAAATAGGACATGAAGGCTGG + Intronic
1026062559 7:67039158-67039180 ATTAAGAATGACAAGTAGGCCGG + Intronic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026258585 7:68734420-68734442 AAGAAGTAGGACAAGAAGGCCGG - Intergenic
1026524473 7:71142350-71142372 AGGAAGAAGGAAATGGAGTCTGG - Intronic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026689573 7:72540244-72540266 AAGAGGAAGAAAAAGAAGGCAGG + Intergenic
1026715787 7:72788273-72788295 ATTAAGAATGACAAGGAGGCCGG - Intronic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027220564 7:76211266-76211288 AGGCAGAGGCACAAGGAGGCAGG + Intronic
1027470286 7:78565086-78565108 GAAAAGAAGGTCAAGGAGGCCGG - Intronic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1027864907 7:83633151-83633173 AGGAGGAAGGAAAAGGAGGAAGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028079682 7:86559591-86559613 AAGAATAAGAACAAACAGGCTGG - Intergenic
1028131286 7:87176917-87176939 AAGAAAAAGGGCAAGGAGTGTGG + Intronic
1028152247 7:87387653-87387675 AAGAAAAATCATAAGGAGGCTGG + Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028261366 7:88670328-88670350 AGGAAGAAGGAAAAGGAGCCTGG - Intergenic
1028451799 7:90993514-90993536 AAGAAGAAGGGGAAGGAAGGAGG + Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1028923237 7:96329471-96329493 AAGAAGAAGGAGCAGCAGCCAGG + Intergenic
1029065430 7:97843559-97843581 AAGACAAAGGAAAAGCAGGCAGG + Intergenic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1029996160 7:105010528-105010550 AAAAACAAGGAAAAGGAGGTTGG + Intergenic
1030509040 7:110460483-110460505 AAGAAGATGGAAGAGGAGGAGGG + Intergenic
1030552494 7:110980510-110980532 AAGATGAAGCACAAATAGGCCGG - Intronic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032017247 7:128388089-128388111 AAGAAAGAGGACAGGGAAGCAGG + Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032298883 7:130668631-130668653 GACAAGAAGGACGAGGAGTCTGG - Exonic
1032438140 7:131919388-131919410 GAGAAGTATGACAAGGATGCTGG + Intergenic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032523151 7:132561436-132561458 AAGGAGGAGGACAAGAAGGAGGG - Intronic
1032654014 7:133907853-133907875 AAGAAGGAGGGGAAGGAGGGAGG + Intronic
1032719586 7:134539650-134539672 AGCAAGAAGGCCAGGGAGGCTGG + Intronic
1032724548 7:134578419-134578441 AGCAAGAAGGCCAGGGAGGCTGG + Intronic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1032817577 7:135492934-135492956 TAGAAGAATGACAATGAGCCAGG + Intronic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033118685 7:138648235-138648257 AGGAAGAGGGGCAACGAGGCAGG + Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033854390 7:145540714-145540736 AAGAAGAAGGAAAAAAAGGAAGG - Intergenic
1033861662 7:145635328-145635350 AAGCAGGAGGCCAAGGAGGGAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034052257 7:147995807-147995829 AAGAATTCGGACAGGGAGGCCGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034435672 7:151061745-151061767 AAAGAGAAGAACAAGGAGACAGG - Intronic
1034711745 7:153198745-153198767 AGGAGGAAGGAAAAGGAGGAAGG - Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035034440 7:155885870-155885892 AGGAAGAAGGAAAAGGATGGGGG - Intergenic
1035472342 7:159118487-159118509 AAGAGGCAGGATCAGGAGGCAGG - Intronic
1036152014 8:6307767-6307789 AGGGAGCAGGACACGGAGGCCGG + Intergenic
1036285658 8:7442497-7442519 AAGAAGGAGGAAACGGAGGGAGG - Intergenic
1036335815 8:7869032-7869054 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1036705506 8:11043392-11043414 AAGGAGCAGGAAGAGGAGGCTGG - Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037568886 8:20141713-20141735 AACAAGGAGGGCAAGGAGGAGGG + Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037816182 8:22113385-22113407 AAGAAGAAGGACAGAGAGGAGGG + Intergenic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1037980128 8:23247141-23247163 AAGAAGGAAAATAAGGAGGCTGG + Intronic
1038139484 8:24827687-24827709 GAGAAGGAGGACAAGGAAGCTGG + Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1038978082 8:32723822-32723844 AAGAAGAAGGGCATGAAGGAAGG + Intronic
1039087999 8:33799044-33799066 AAGGAGAAGGTCATGGAGGAGGG + Intergenic
1039142741 8:34411146-34411168 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039622363 8:39010033-39010055 AAGAAGGGGGATAGGGAGGCTGG + Intronic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039895243 8:41712520-41712542 AAGGACAAGGACAACTAGGCTGG + Intronic
1040365274 8:46709008-46709030 AAGACAAAGGAAAAGCAGGCAGG - Intergenic
1040659688 8:49556915-49556937 ATAAAGAAATACAAGGAGGCTGG + Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040796957 8:51297753-51297775 AAGAGGAAAGGCAAGGGGGCAGG - Intergenic
1041037045 8:53803038-53803060 AAGAAGTAGAGAAAGGAGGCTGG + Intronic
1041147687 8:54895213-54895235 AAAAAGAGGGACAAGAGGGCAGG - Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041291155 8:56310085-56310107 AAGAAGGAGGAAGAGGAGGAAGG + Intronic
1041312336 8:56529685-56529707 AAGCAGAAGGACATGGAGTTTGG + Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG + Intergenic
1041831536 8:62160688-62160710 AAGAAGTAGGAGGAGGAGGAAGG + Intergenic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1042106603 8:65333938-65333960 AAGAAGGAGGAAAAGGAGAGTGG + Intergenic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043407285 8:79950957-79950979 AGGAAGAAGGAAATGGAGGTGGG - Intronic
1043746939 8:83886196-83886218 AAGGAGATGGAAAGGGAGGCAGG + Intergenic
1043786575 8:84408738-84408760 AATAAGAATGCCATGGAGGCAGG + Intronic
1044050609 8:87498300-87498322 AAGAAGTGGGACAAGAAGACAGG - Intronic
1044152432 8:88798034-88798056 AAGAAGAAAGAAAAAGAGGAAGG - Intergenic
1044642301 8:94396073-94396095 AAGAAGAAGGAAAAAGAGTAAGG + Intronic
1044688030 8:94846568-94846590 AAGAATAAGTAAAAAGAGGCTGG - Intronic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044831150 8:96250678-96250700 AAGAAGGAGGAGGAGGAGGGGGG + Intronic
1045497191 8:102718654-102718676 AAGAAGAAATACAAGGGAGCTGG + Intergenic
1045534319 8:103012897-103012919 AAAAAGAAAAAAAAGGAGGCCGG + Intergenic
1045737952 8:105318584-105318606 AAGAAGGAAGAGAAGGAGGGAGG - Intronic
1045834863 8:106507965-106507987 AAGAAGAAGCCAGAGGAGGCTGG - Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046184474 8:110694624-110694646 AGGAAGAAGGACAAAGAGGAAGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1047112938 8:121811116-121811138 AAGATGAAGGAAGAGGAGGAGGG + Intergenic
1047232396 8:123008666-123008688 AAGAAGGAGGAAACGGATGCTGG - Intergenic
1047509062 8:125502410-125502432 AAGAGCAAAGACATGGAGGCTGG - Intergenic
1047661134 8:127038246-127038268 AAAGAGAAGGACAAGCAGCCAGG - Intergenic
1047728867 8:127709199-127709221 AAGAATGAGGCCAAGGAGGCCGG - Intergenic
1047798671 8:128285620-128285642 AAGAAGAAGGAGAAGGAAAAGGG + Intergenic
1047945108 8:129869087-129869109 AAGAAGAAAGAAAAAAAGGCTGG + Intronic
1048430863 8:134369282-134369304 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1048889422 8:138934437-138934459 AAAAAGAAGGAAGAGGAGGAAGG + Intergenic
1048941146 8:139401954-139401976 GAGAAGAAGGATAAGGGGGATGG - Intergenic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049455534 8:142684494-142684516 GAGAAGAAGGGCAAGGATGCGGG + Intergenic
1050212949 9:3284704-3284726 AAGAAGAAATACAAGTAGACAGG - Intronic
1050358547 9:4805390-4805412 AAGAAGAAGGAGAAGGGGAAGGG + Intronic
1050489283 9:6170670-6170692 AAGAAGAAGGAAAAATAGGTAGG - Intergenic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1051216419 9:14803006-14803028 AAGAAGAAAGAAAGGGAGGGAGG - Intronic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051562891 9:18462640-18462662 TAGAAGAAGGAAAAAGGGGCCGG + Intergenic
1051858838 9:21601041-21601063 CAAAGGAAGGACAAGAAGGCTGG + Intergenic
1052207504 9:25860844-25860866 AAGCAGAAGGGAAAGCAGGCAGG - Intergenic
1052425882 9:28303844-28303866 AAGGAGATAGAAAAGGAGGCAGG + Intronic
1052976791 9:34417057-34417079 AAGAAGAAGGAGAAGGGGAAGGG - Intronic
1053018468 9:34677809-34677831 AAGAGGTAGGACACAGAGGCTGG - Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1055254980 9:74358668-74358690 AAGAAGAAGGACATAGGGGCAGG - Intergenic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1055618061 9:78093826-78093848 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1055706337 9:79008908-79008930 AAGAAGAAAGGAAAGAAGGCAGG + Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056645642 9:88409289-88409311 AAGAAAAAAGAAAAGCAGGCCGG - Intronic
1056820730 9:89840168-89840190 AGGAAAAGGGACTAGGAGGCAGG + Intergenic
1056842205 9:90007423-90007445 AAGCAGAAGGAAAATCAGGCAGG - Intergenic
1057132787 9:92666344-92666366 AAGCTGAAGGCGAAGGAGGCAGG + Intronic
1057242731 9:93426515-93426537 TAGAAACAGGACATGGAGGCAGG - Intergenic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057555069 9:96081575-96081597 GAGAGGAAGGATAAGGGGGCAGG - Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1058409458 9:104715263-104715285 AAGAAGAAGGAGAAGGAAAAGGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058672700 9:107373961-107373983 AGAAAGAAGGCCAAGGCGGCTGG + Intergenic
1058953183 9:109922453-109922475 AAAAAGATGGAAAAGGAGGAAGG + Intronic
1058965165 9:110030712-110030734 AATAAAAAGGGCAAGGGGGCAGG - Intronic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059174395 9:112155870-112155892 AGGAAGAAGGAGAAGGAGAGAGG + Intronic
1059174404 9:112155926-112155948 AAGAAGGAAGAGAAGGAGGAAGG + Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1059799485 9:117735881-117735903 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1059936314 9:119314605-119314627 AAGTAGACTGACAAGGAGGGCGG - Intronic
1060067001 9:120511165-120511187 AAGAAGAGGCACAATGAGACTGG + Intronic
1060200404 9:121649044-121649066 AGGAAGAAGGAAAAGGAGCCTGG + Intronic
1060489450 9:124071762-124071784 AAGAAAAAGAACAAGGAGAAGGG - Intergenic
1060596286 9:124851076-124851098 AAGAGTAAGGACAGGCAGGCAGG + Intergenic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1060779866 9:126403432-126403454 GAGAAGAAGGAAAACGACGCAGG - Intronic
1061166626 9:128926534-128926556 AAGAAAAAGAAAAAGGAAGCTGG - Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061385632 9:130287806-130287828 AAGAGGAAGGAGAGAGAGGCAGG + Intronic
1061483393 9:130908432-130908454 AAAGATAAGGACAAGGCGGCAGG - Intronic
1061559569 9:131394014-131394036 GAGGAGGAGGACGAGGAGGCGGG + Intergenic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1061866167 9:133492757-133492779 AAGAAGGAGGACAGGGGAGCCGG + Intergenic
1061979031 9:134089314-134089336 AAGAAGAAGGGAAAGATGGCTGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062206306 9:135339441-135339463 GAGAAGAAGCTCCAGGAGGCCGG + Intergenic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1062605564 9:137347102-137347124 TAGAAAAATGACATGGAGGCTGG - Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1203472800 Un_GL000220v1:123906-123928 AAGAAGAAAGGCAGGAAGGCAGG - Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185550471 X:979915-979937 AAGAAGAGGGAAGAGGCGGCCGG + Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186240625 X:7561491-7561513 AAAAAGAAGGCCAAGGCGGGTGG - Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186264625 X:7818772-7818794 AAAAAGAAGGAAAAGGAGAAGGG + Intergenic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1186676459 X:11822445-11822467 AAGAGGAAGTCTAAGGAGGCTGG + Intergenic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1186821808 X:13296489-13296511 CAGAAGAAAGACAAAGAAGCAGG - Intergenic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187313106 X:18165779-18165801 AAGAAGACAGACAAGGAGAAAGG + Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1188033208 X:25287805-25287827 AAGAAGAAGGAAAAAGAGAGGGG - Intergenic
1188269297 X:28118878-28118900 GGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1188586000 X:31776578-31776600 AAGAAGAAAGTCAGGGAGGGAGG + Intronic
1188891616 X:35618284-35618306 GAGAAGAAGGGCAGGGAGGATGG + Intergenic
1189217678 X:39341012-39341034 AAGAAGAGGGAGAAGGTGTCAGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189341026 X:40204692-40204714 AAAAAGAAGGAAATTGAGGCTGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189713601 X:43841376-43841398 AACAAGAAGGAAAATTAGGCAGG + Intronic
1189737780 X:44089096-44089118 GAGAGGAAGAACAAGGAGGAGGG + Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1189863179 X:45294361-45294383 AGGAAGAAGGCCAGTGAGGCTGG - Intergenic
1189913071 X:45830379-45830401 AAGGTGGAGGACAAGAAGGCAGG + Intergenic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190047538 X:47124738-47124760 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1190259763 X:48790526-48790548 GAGAAGGAGGACAAGGAAGAGGG + Intronic
1190668053 X:52713495-52713517 AAGAAGAAGAATAAGGTGGGAGG - Intergenic
1190671364 X:52744909-52744931 AAGAAGAAGAATAAGGTGGGAGG + Intergenic
1190704087 X:53011552-53011574 AAGAAGAAAAAAAAAGAGGCCGG - Intergenic
1190718797 X:53129383-53129405 AAGAAGAAGAAAAATCAGGCTGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1192095669 X:68207975-68207997 AGAAAGAAGGAAAAGGAGGAAGG - Intronic
1192130219 X:68542879-68542901 AAAAAGAAGAAGAAGAAGGCTGG - Intergenic
1192141064 X:68647604-68647626 AGGAGGAGGGACCAGGAGGCGGG - Intergenic
1192379164 X:70597330-70597352 AAAAAGAAGAACAATGAGGGGGG + Intronic
1192436443 X:71146103-71146125 AAGAAAAAGGAAGAGGAGGGAGG - Intronic
1192530733 X:71882074-71882096 ATGAAGAAGAACAAGGTGGGAGG + Intergenic
1192830210 X:74743391-74743413 AAGAAGAAAGGCAAAGAGGAAGG - Exonic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193851506 X:86543139-86543161 AAGAATGAGGACACAGAGGCAGG + Intronic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194060025 X:89184739-89184761 AAGAAGAAGGACAAGTACACTGG + Intergenic
1194079404 X:89439932-89439954 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1194220130 X:91179390-91179412 AAGAATAAGGACAGGCAGACTGG + Intergenic
1194423732 X:93710122-93710144 AAGAAGAAGAAAAAGAAGTCTGG + Exonic
1194472301 X:94311835-94311857 AAGAAGAAGGGCAACGTGCCTGG - Intergenic
1194847735 X:98832531-98832553 AACAAGAAGAAAAAGGAGGAAGG - Intergenic
1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG + Intronic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195216400 X:102708251-102708273 AAGAAGAAGGACAAGGTCAGAGG + Intergenic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1196206128 X:112942081-112942103 AACAAAAAGGAAAAGGAGGAAGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1196789261 X:119449431-119449453 AAGAAGAATGAATTGGAGGCTGG + Intronic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198116500 X:133549782-133549804 AAAAAGAAGGACAGGGAGGGAGG - Intronic
1198116512 X:133549826-133549848 AAAAAGAAGGACAGGGAGGGAGG - Intronic
1198273639 X:135080145-135080167 AAGAAGCTGGACTAGGAGACTGG - Intergenic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199009561 X:142743124-142743146 TAGATTAAAGACAAGGAGGCTGG - Intergenic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199312769 X:146340924-146340946 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1199406083 X:147462421-147462443 AAAAAAAAAGATAAGGAGGCTGG + Intergenic
1199435152 X:147804672-147804694 AAGAAAAATGACAGGGATGCTGG + Intergenic
1199702918 X:150398387-150398409 AAGAAGAAGAAGAAGAAGACAGG + Intronic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200432022 Y:3095237-3095259 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1200556642 Y:4643147-4643169 AAGAATAAGGACAGGCAGACTGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic
1201541059 Y:15105445-15105467 AAGAAGAAAGAAGAGGAGGGAGG - Intergenic
1201741072 Y:17325299-17325321 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1201927406 Y:19302811-19302833 AAGAAGAAGGAAAAGAAGCAAGG - Intergenic
1202346393 Y:23932535-23932557 ATTAAGAAGGACAAGGATGGTGG - Intergenic
1202524378 Y:25737555-25737577 ATTAAGAAGGACAAGGATGGTGG + Intergenic