ID: 1072842472

View in Genome Browser
Species Human (GRCh38)
Location 10:98789700-98789722
Sequence CCTCATTTCTTATAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072842468_1072842472 12 Left 1072842468 10:98789665-98789687 CCTAAAGGAGATGACAGCCGGAA 0: 1
1: 0
2: 1
3: 14
4: 144
Right 1072842472 10:98789700-98789722 CCTCATTTCTTATAGCTGGATGG No data
1072842469_1072842472 -5 Left 1072842469 10:98789682-98789704 CCGGAAGCTGTCTATTGACCTCA 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1072842472 10:98789700-98789722 CCTCATTTCTTATAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072842472 Original CRISPR CCTCATTTCTTATAGCTGGA TGG Intronic
No off target data available for this crispr