ID: 1072847281

View in Genome Browser
Species Human (GRCh38)
Location 10:98845754-98845776
Sequence GTGCACTGGTCAGGACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 179}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072847281_1072847288 7 Left 1072847281 10:98845754-98845776 CCAGTGTGTCCTGACCAGTGCAC 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1072847288 10:98845784-98845806 TCATGGACTAAAATAAGGTTGGG No data
1072847281_1072847290 14 Left 1072847281 10:98845754-98845776 CCAGTGTGTCCTGACCAGTGCAC 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1072847290 10:98845791-98845813 CTAAAATAAGGTTGGGAACTGGG No data
1072847281_1072847286 2 Left 1072847281 10:98845754-98845776 CCAGTGTGTCCTGACCAGTGCAC 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1072847286 10:98845779-98845801 GTGTGTCATGGACTAAAATAAGG No data
1072847281_1072847289 13 Left 1072847281 10:98845754-98845776 CCAGTGTGTCCTGACCAGTGCAC 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1072847289 10:98845790-98845812 ACTAAAATAAGGTTGGGAACTGG No data
1072847281_1072847291 25 Left 1072847281 10:98845754-98845776 CCAGTGTGTCCTGACCAGTGCAC 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1072847291 10:98845802-98845824 TTGGGAACTGGGTAATTTGCAGG No data
1072847281_1072847287 6 Left 1072847281 10:98845754-98845776 CCAGTGTGTCCTGACCAGTGCAC 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1072847287 10:98845783-98845805 GTCATGGACTAAAATAAGGTTGG No data
1072847281_1072847284 -10 Left 1072847281 10:98845754-98845776 CCAGTGTGTCCTGACCAGTGCAC 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1072847284 10:98845767-98845789 ACCAGTGCACAGGTGTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072847281 Original CRISPR GTGCACTGGTCAGGACACAC TGG (reversed) Intronic
900358759 1:2277901-2277923 ACGCACTCGTCAGGACCCACGGG + Intronic
905296007 1:36954894-36954916 GTGCACAGGTGGGTACACACAGG - Intronic
905451000 1:38056129-38056151 TCTCACTGGTCAGGACACCCTGG + Intergenic
905888100 1:41502519-41502541 GGGCACTGCTCAGGAGACCCTGG - Intergenic
908251364 1:62268533-62268555 GGGCACTGGGCAGGAAAGACAGG - Intronic
911739516 1:101371703-101371725 TTGCACTCGACAGGACAGACTGG - Intergenic
912363063 1:109110965-109110987 GTGCACAGGGCAGGACTGACAGG - Intronic
913508368 1:119540023-119540045 GTGCACAGGGCAGGACCCTCTGG - Intergenic
913550776 1:119915445-119915467 GACCACTGGTCAGGAGACTCTGG + Exonic
915597905 1:156905836-156905858 GTGCAGTGGGCAGGAGAGACTGG - Intronic
918119383 1:181524554-181524576 GAGCACTGTTCAGGACACACTGG - Intronic
919010555 1:191956195-191956217 GTACAGTGTTCAGAACACACTGG + Intergenic
922534299 1:226368436-226368458 GTGCACATGCCAGGACACATGGG + Intronic
922685945 1:227638993-227639015 GTGCCCTGGAAAGGACACCCTGG - Intronic
924571255 1:245239781-245239803 TTTTACTGGTCAGGACACAATGG - Intronic
1064118808 10:12601942-12601964 TTGCCCTGGGCAGGACACACAGG - Intronic
1064292759 10:14050829-14050851 GTGCACTGGGCAGGGCATGCGGG - Intronic
1067238040 10:44468167-44468189 GGGCTGTGGTCAGGACACAGAGG - Intergenic
1068083627 10:52347946-52347968 GAACACTGGTCAGGACACCCTGG + Intergenic
1070639293 10:78155086-78155108 GTGCACTGGTGAGGGGACAATGG - Intergenic
1070802120 10:79249972-79249994 CTGCACTGATCAGGAAACAGAGG - Intronic
1072847281 10:98845754-98845776 GTGCACTGGTCAGGACACACTGG - Intronic
1072875261 10:99165845-99165867 GTGCACTTGTCAAAACCCACAGG - Intronic
1073725638 10:106227036-106227058 GTGCACTGCCCAGGGCACAATGG + Intergenic
1073942024 10:108710471-108710493 GTGGACTGTGCAGGAAACACAGG - Intergenic
1075007881 10:118843460-118843482 GAACACTGGTCGGGACACTCTGG + Intergenic
1075656022 10:124161859-124161881 CTGCTCTGTTCAGGGCACACTGG - Intergenic
1077057412 11:601494-601516 GTCCACTGGGCTGGACTCACAGG + Intronic
1079073752 11:17370379-17370401 GTGCATTGGCCAGGAAACATTGG + Intronic
1079131052 11:17747228-17747250 GTGACCTGCCCAGGACACACAGG - Intronic
1080241263 11:30129548-30129570 GTTCACTAGTTAGGACACAAGGG - Intergenic
1084594874 11:70110906-70110928 GCGCACCTGTTAGGACACACAGG + Intronic
1085380702 11:76115307-76115329 GTGCTCTGGTCTGGACAAAGAGG + Intronic
1086427440 11:86699869-86699891 GTGCATGGGGCAGGGCACACTGG - Intergenic
1089560942 11:119342784-119342806 GGACCCTGGTCAGGACACTCTGG - Intronic
1090124846 11:124075189-124075211 GAACACTTGTCAGGACACTCCGG - Intergenic
1091724489 12:2836194-2836216 GTGCACTGGTAAAAACACTCTGG - Intronic
1094484724 12:30915413-30915435 GTGCATTGGTCAGCAGACTCCGG + Intergenic
1095548053 12:43395807-43395829 ATGCACTGGTGAGGGGACACAGG + Intronic
1102451293 12:113043850-113043872 GTGCACTGGCAAGGAGGCACAGG - Intergenic
1103280502 12:119754331-119754353 GTGCAATGGTCAGGACACGTAGG - Intronic
1104485718 12:129149857-129149879 GAGGAGTGTTCAGGACACACAGG - Intronic
1104962211 12:132493657-132493679 GTGCCCTGGATGGGACACACAGG + Intronic
1105202682 13:18193581-18193603 GTGCACTGGTCAGGCCACCTAGG + Intergenic
1108599931 13:51983600-51983622 GTCTCCTGGTCAGGAGACACAGG - Intronic
1112845019 13:103631512-103631534 GATCACTGGTCCAGACACACTGG + Intergenic
1114836406 14:26207925-26207947 GCACACTGGGCCGGACACACAGG + Intergenic
1119189269 14:72669349-72669371 GTGCACAGTTCTGGAAACACAGG - Intronic
1121072530 14:91037492-91037514 ATGCACTGGTGAGGGGACACAGG - Intronic
1121465519 14:94113129-94113151 GTGCTCTGGGCAGGACAGAAGGG + Intronic
1122159860 14:99775098-99775120 GCGCACTGCCCAGGACACAGAGG + Intronic
1123207220 14:106725159-106725181 GTGCACAGGTGAGGTCTCACAGG - Intergenic
1123212244 14:106772162-106772184 GTGCACAGGTGAGGTCTCACAGG - Intergenic
1123888400 15:24749629-24749651 GAACACTCGTCAGGACACCCTGG + Intergenic
1124436343 15:29652284-29652306 GAACACTCGTCAGGACACCCTGG + Intergenic
1125416188 15:39455549-39455571 GTGTGATGGTCAGGACAGACTGG + Intergenic
1129878406 15:78992010-78992032 GAGCACTGGGCTGCACACACCGG - Intronic
1134463294 16:14448694-14448716 GTGCACTTGATAGGACACTCAGG + Intronic
1134506090 16:14808288-14808310 CTGTACTGGTCAGGACACTTTGG + Intronic
1134574460 16:15320482-15320504 CTGTACTGGTCAGGACACTTTGG - Intergenic
1134727956 16:16435821-16435843 CTGTACTGGTCAGGACACTTTGG + Intergenic
1134939480 16:18276005-18276027 CTGTACTGGTCAGGACACTTTGG - Intergenic
1138751157 16:59422791-59422813 GTCCAATGGTCAGGACATGCTGG - Intergenic
1140266405 16:73425068-73425090 ATGCACTGGTCAGGGCAGAGAGG - Intergenic
1140381279 16:74490109-74490131 GTTCACTGCACAGGGCACACTGG + Intronic
1141079393 16:81036668-81036690 GTCCACTGGGCAGGACCCAAGGG - Intronic
1141266542 16:82502816-82502838 GGCCAATGGTCAGGACCCACCGG - Intergenic
1141420565 16:83912653-83912675 CTGACCTGGTCAGGACACTCTGG + Intronic
1143203448 17:5127592-5127614 GGGCCCAGTTCAGGACACACAGG - Exonic
1143655601 17:8291704-8291726 ATTCACTGGTCAGGAGAAACAGG + Intronic
1143840682 17:9728866-9728888 GTGCACTGGGCATGTCACAAAGG + Exonic
1145999370 17:29122123-29122145 GGGCACATGTCAGGACTCACTGG - Intronic
1149848281 17:60020287-60020309 GGGCCCAGTTCAGGACACACAGG + Intergenic
1149861888 17:60126237-60126259 GGGCCCAGTTCAGGACACACAGG - Intergenic
1150086633 17:62276854-62276876 GGGCCCAGTTCAGGACACACAGG + Intronic
1151773141 17:76177935-76177957 GGACACTTGTCAGGACACCCTGG + Intronic
1153225180 18:2894357-2894379 GTGCAGTGGGCTGGACACTCGGG - Intronic
1158198021 18:54910126-54910148 GGACACTTGTCAGGACACCCTGG - Intronic
1160421790 18:78753099-78753121 ATCCACTGGTCAGCAAACACGGG + Intergenic
1161724410 19:5919965-5919987 CTGCTCTGGTCAGAACAGACAGG - Intronic
1161791508 19:6362570-6362592 GGGCACTCGTCAGGGCACACGGG + Intronic
1162985580 19:14267269-14267291 AGGCACAGGTCAGGGCACACTGG - Intergenic
1165257627 19:34589284-34589306 GAGCACTGGTCAGGGCAGAGAGG + Intergenic
1165282501 19:34809298-34809320 GTGCACTGGTGAGGGCATAGGGG + Intergenic
1165434518 19:35788711-35788733 GTGCACAGGTCAGGACATGCTGG - Exonic
1166698062 19:44865512-44865534 GAGCACTGGGCAAGACACAGAGG + Exonic
1168684805 19:58342135-58342157 GTAGACTGGGCAGCACACACAGG - Exonic
925556256 2:5134287-5134309 GGGCTCTGCACAGGACACACAGG + Intergenic
927464679 2:23328339-23328361 GTGAACTGGTGTGGATACACTGG + Intergenic
927487107 2:23496069-23496091 GGGCACTGTGAAGGACACACGGG - Intronic
927743142 2:25590440-25590462 GAACACTTGTCAGGACACCCTGG - Intronic
931918890 2:66990875-66990897 GTGGACTGCTCAGCCCACACAGG + Intergenic
932667173 2:73707449-73707471 GTGCAATGGTTTGGACCCACTGG + Intergenic
933801104 2:85961096-85961118 GAACACTTGTCAGGACACCCTGG - Intergenic
942246027 2:174009183-174009205 GTGTAGTGTTCAGTACACACTGG - Intergenic
944901755 2:204223138-204223160 GAACACTCGTCAGGACACCCTGG - Intergenic
945160510 2:206885508-206885530 GAGCACTGGTCTAGACAGACAGG - Intergenic
946369350 2:219271157-219271179 GTGCACTGGTCAGCCTAGACAGG - Intronic
947082846 2:226418525-226418547 CTGCCCTGGGCAGGACACAGGGG + Intergenic
947231844 2:227895553-227895575 GAGCAGTGGAGAGGACACACGGG + Intronic
947461404 2:230307172-230307194 GAACACTCGTCAGGACACATTGG + Intronic
947610628 2:231522874-231522896 GTCCACTGGGCAGGACTGACAGG + Intergenic
947758796 2:232588358-232588380 GGGAACTGGTCAGGAGACAGAGG - Intergenic
1170043807 20:12065160-12065182 GAACACTTGTCAGGACACCCTGG - Intergenic
1170898318 20:20436561-20436583 GGGCCCTGGCCAGGACACAAAGG + Intronic
1171755208 20:29100877-29100899 GTGCTGTGGCCAGGACACAGGGG + Intergenic
1171787480 20:29482016-29482038 GTGCTATGGCCAGGACACAGAGG - Intergenic
1171860473 20:30397365-30397387 GTGCTATGGTCAGGACAGAGGGG + Intronic
1175186920 20:57184971-57184993 GGGCCCTGGTCAGGACACCAAGG + Intronic
1176090973 20:63318504-63318526 GGGCACTGGCCAGGACCCACTGG + Intronic
1176715270 21:10344424-10344446 GTGCATTGGTCAGGCCACCTAGG - Intergenic
1178671767 21:34596900-34596922 GTGCGTTGGTCTGCACACACTGG + Intronic
1179173676 21:38992036-38992058 GTCCACTGGTCATGACACCTGGG + Intergenic
1180296432 22:10941254-10941276 GTTCTCTGGCCAGGACACAGGGG - Intergenic
1180412242 22:12624746-12624768 GTGCTATGGCCAGGACACAGGGG + Intergenic
1180790201 22:18571723-18571745 GTTCAGTTGTCAGAACACACCGG - Intergenic
1180921940 22:19525535-19525557 GTCCACTGGTGTGGACACTCCGG + Intronic
1181231537 22:21423592-21423614 GTTCAGTTGTCAGAACACACCGG + Intronic
1181247114 22:21511276-21511298 GTTCAGTTGTCAGAACACACCGG - Intergenic
1183198399 22:36369042-36369064 CTGCACAGGTCAGCACACCCAGG + Intronic
1183456006 22:37923772-37923794 GTGGATGGGCCAGGACACACAGG - Intronic
1184654413 22:45933943-45933965 GGGCACTTGTCTGGCCACACAGG + Intronic
1184891386 22:47381443-47381465 GGTCACTGGTCAGGGGACACTGG - Intergenic
949410218 3:3755325-3755347 ATGCACTGTGAAGGACACACTGG - Intronic
952414942 3:33081750-33081772 GTCCACAGGTCAGCACACCCTGG - Intronic
954923087 3:54208579-54208601 TGGCACTGGTAAGGCCACACAGG - Intronic
961980773 3:131075787-131075809 TTGCACTGATCAGGACTCCCAGG + Intronic
965318903 3:167227044-167227066 TTGCATTAGTTAGGACACACTGG - Intergenic
969273138 4:6116435-6116457 GATGACTGCTCAGGACACACAGG + Intronic
971938749 4:33188346-33188368 GAACACTTGTCAGGACACCCTGG - Intergenic
972930981 4:44071472-44071494 GAGCACTCCTCAGGACACGCTGG - Intergenic
974285097 4:59855578-59855600 GAACACTTGTCAGGACACCCTGG - Intergenic
977781373 4:100985334-100985356 GTGCTAGAGTCAGGACACACAGG + Intergenic
978498507 4:109384832-109384854 GAACACTAGTCAGGACACCCTGG + Intergenic
978625550 4:110680798-110680820 GTGCACTGGACAGGACATAATGG + Intergenic
982009436 4:151092538-151092560 GTACATTGGTCAGGAAAGACAGG + Intergenic
982274243 4:153623081-153623103 GGGCTCTGCTCAGGACTCACCGG - Exonic
985438653 4:189961255-189961277 GTGCTATGGCCAGGACACAGGGG + Intronic
985613039 5:900846-900868 GTGCAGGGGTTAAGACACACCGG - Intronic
986848799 5:11786019-11786041 CTGCACTGGTCTGGGCACCCAGG - Intronic
989175547 5:38521710-38521732 GTGCACTGCTCAAGACCCAGAGG - Intronic
989279130 5:39621557-39621579 GAACACTAGTCAGGACACCCTGG - Intergenic
994851293 5:105057670-105057692 GAACACTTGTCAGGACACCCTGG + Intergenic
1004770384 6:18774615-18774637 TTGCACTGCTCAGGAAACAAAGG + Intergenic
1005118480 6:22364457-22364479 GTGCACAGGGCAGAACATACGGG + Intergenic
1005775893 6:29130338-29130360 GAACACTGGTCAGGACACCCTGG + Intergenic
1006311606 6:33264995-33265017 ATGCACTGGACAGGACAGAAGGG + Intronic
1006466132 6:34196026-34196048 CTGCAGTGGTCAGGAGACAGTGG + Intergenic
1006599794 6:35217756-35217778 GTGCCCTGTCCAGGCCACACTGG + Intronic
1006737855 6:36287419-36287441 GTACCCTGATCAGGACACATTGG + Intronic
1007401657 6:41606028-41606050 GTGGACTGGGCAGGACACCTGGG + Intergenic
1009319098 6:62263777-62263799 GTGAAATGGTCTTGACACACTGG + Intronic
1016603286 6:145888568-145888590 GTGCAGGGGCCAGGTCACACAGG + Intronic
1017954402 6:159167096-159167118 GTGCACTAGTCAAGACTCATTGG + Intergenic
1018345359 6:162893467-162893489 GTGCACTTCTCAGTTCACACTGG + Intronic
1019200967 6:170314936-170314958 TTGGACTGCTCAAGACACACAGG - Intronic
1019564995 7:1674740-1674762 GGGCACTGGGCACAACACACAGG - Intergenic
1028518993 7:91707988-91708010 TTGCACTGCTCAGGACACAGAGG + Intronic
1029117188 7:98243398-98243420 GTGCACAGGACAGGACCCACAGG + Intronic
1029483155 7:100824833-100824855 GTGCCCTGATCAGGAAGCACTGG + Intronic
1033601939 7:142894623-142894645 GTGCACAGGGCACTACACACAGG - Intergenic
1034386099 7:150742505-150742527 TTTCACTGCTCAGGACACAGTGG + Exonic
1034386839 7:150747420-150747442 TTTCACTGCTCAGGACACAGTGG - Intronic
1035224044 7:157424007-157424029 GTGGCCTCGTCAGGACACACAGG - Intergenic
1035378508 7:158423446-158423468 GTGCCCTGGGCAGGACAGGCAGG - Intronic
1039911743 8:41832109-41832131 GTGCATTTGTCAGAACTCACAGG + Intronic
1042337001 8:67639902-67639924 GAACACTTGTCAGGACACCCTGG - Intronic
1043039495 8:75243304-75243326 GTGCACTGCTCAAGACACTTAGG - Intergenic
1047260441 8:123253895-123253917 GTGCATTTGTCCGGACACAGTGG - Exonic
1048161935 8:132029284-132029306 GTGCACTGGAAAGGAGGCACTGG - Intronic
1049039082 8:140098900-140098922 GTGCACAGGGGAGGACACCCAGG + Intronic
1049379907 8:142306920-142306942 GGACACTGGTCAGGACCCCCGGG + Intronic
1049564130 8:143329113-143329135 GTGCACTAGGCTGGACACACTGG + Intronic
1050143201 9:2538273-2538295 TTGCACTGCTCAGGCCACAGGGG + Intergenic
1050166676 9:2771656-2771678 GTGCACTAGTCATTACATACAGG - Intronic
1053747660 9:41216527-41216549 GTGCTATGGCCAGGACACAGGGG + Intergenic
1054479624 9:65648845-65648867 GTGCTATGGCCAGGACACAGGGG - Intergenic
1056406363 9:86279844-86279866 GTGCCCTAGTCAGGACACTATGG - Intronic
1057230738 9:93319938-93319960 GTGGACCGGGCAGGAGACACTGG - Intronic
1059468847 9:114488270-114488292 TTGCACTGGGCAGGGCGCACAGG + Intronic
1059724103 9:116989252-116989274 ATGCCATGGGCAGGACACACAGG - Intronic
1060526787 9:124325393-124325415 GGGAACTGACCAGGACACACTGG - Intronic
1061004785 9:127922287-127922309 GTGCACTGTTCAGTAGACATTGG + Intronic
1062456600 9:136642495-136642517 ATGCACTGGCCAGGAGAGACGGG - Intergenic
1202783794 9_KI270718v1_random:27298-27320 GTGCTATGGCCAGGACACAGGGG + Intergenic
1202803284 9_KI270720v1_random:22292-22314 GTGCTATGGCCAGGACACAGGGG - Intergenic
1203448076 Un_GL000219v1:79499-79521 GTGCTATGGCCAGGACACAGGGG - Intergenic
1194866512 X:99075360-99075382 CTGGACTGGGCAGGAGACACTGG - Intergenic
1197703297 X:129615971-129615993 GTGGGCTGGTCTGGACACAGTGG + Intergenic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1198106635 X:133468244-133468266 GTGGACTAGGCAGGCCACACAGG + Intergenic
1198275523 X:135095084-135095106 GTGTACTGGTCAGCACAGGCTGG - Intergenic
1198310998 X:135425642-135425664 GTGTACTGGTCAGCACAGGCTGG + Intergenic
1202342202 Y:23881759-23881781 GTTCCCTAGTCAGGAGACACAGG + Intergenic
1202528567 Y:25788326-25788348 GTTCCCTAGTCAGGAGACACAGG - Intergenic