ID: 1072854889

View in Genome Browser
Species Human (GRCh38)
Location 10:98936318-98936340
Sequence ACTTGGAACTCTAGTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072854889 Original CRISPR ACTTGGAACTCTAGTGAGAC AGG (reversed) Intronic
902607401 1:17576253-17576275 ACTTTGAACCCTAGTGGGAGGGG + Intronic
909211488 1:72830570-72830592 GCCTGGAACTCCAGTGAGACAGG + Intergenic
910376930 1:86582652-86582674 ACTTGGATAGCTAGTGATACAGG - Intergenic
911284649 1:95974946-95974968 ACCTGGAACTCCAGTGACACAGG - Intergenic
912276271 1:108261970-108261992 ACCTGGAACTCCAGTGAGGCAGG + Intergenic
912291957 1:108432388-108432410 ACCTGGAACTCCAGTGAGGCAGG - Intronic
915046109 1:153018404-153018426 ACCTGGAACTCCAGTGAGGCAGG + Intergenic
915659334 1:157389161-157389183 TCTGGGAACTCTGGTGAGGCAGG - Intergenic
917232839 1:172856280-172856302 ACCTGGAACCCCAGTGAGACAGG - Intergenic
918786308 1:188768929-188768951 ACCTGGAACTCCAGTGAGGCAGG + Intergenic
918938404 1:190955147-190955169 AATTGGAGCTCTAATGAGAAGGG - Intergenic
919690154 1:200521943-200521965 ACTTGGAGATCTGTTGAGACAGG - Intergenic
919780985 1:201221083-201221105 ACATGGAAGTCTAGTCATACGGG + Intronic
921342074 1:214144314-214144336 AGCTGGAACTCAAGGGAGACGGG + Intergenic
924694174 1:246382321-246382343 ACCTGGCATTCTAGTGAGCCTGG - Intronic
924883643 1:248189056-248189078 GCCTGGAACTTCAGTGAGACAGG + Intergenic
924894081 1:248316996-248317018 ACCTGGAACTCCAGTGTGACAGG - Intergenic
1067251986 10:44594247-44594269 ACCTGGAACTCCAATGAGACAGG + Intergenic
1068410455 10:56646959-56646981 ACCTGTAACTCCAGTGAGACAGG - Intergenic
1072854889 10:98936318-98936340 ACTTGGAACTCTAGTGAGACAGG - Intronic
1075111190 10:119586097-119586119 GTTTGCAACTCTAGAGAGACCGG - Intronic
1075559335 10:123457021-123457043 AGTGGGAACTCTAGTGGGCCAGG - Intergenic
1077839033 11:5953479-5953501 ACTTGGAACTCTATTAAGATGGG - Intergenic
1079024223 11:16933305-16933327 GCATGGAACTGTAGTCAGACTGG - Intronic
1079276216 11:19040149-19040171 TCTGGGAACTCTCGTGAGGCAGG + Intergenic
1081269328 11:41065031-41065053 GCCTGGTACTCCAGTGAGACAGG + Intronic
1082801677 11:57419488-57419510 CCTTCCAACTCTAGAGAGACAGG + Intronic
1085734106 11:79024301-79024323 TCTTGGAAGTCTAGGGAGGCTGG - Intronic
1085850039 11:80109473-80109495 GCCTGGAACTCCAATGAGACAGG + Intergenic
1085908870 11:80797917-80797939 ACCTGGAAGTCCAGAGAGACAGG + Intergenic
1088008286 11:104969014-104969036 TCCCGGAACTCTAGTGAGGCAGG + Exonic
1088017784 11:105081568-105081590 TCCTGGAACTCTAGTGAGGCAGG + Intronic
1088020355 11:105111543-105111565 TCTCGGAACTCTAGTGAGGCAGG + Intergenic
1093154334 12:15663290-15663312 ACTAGGAACCCTAGTGCCACTGG + Intronic
1095193230 12:39283141-39283163 AGTTGGAAGTCAAGTGAGAAAGG + Intergenic
1095293778 12:40505830-40505852 ACTTGGGTCTCTAGTGATCCAGG - Intronic
1095294088 12:40508780-40508802 ACTTGGCTCTCTAGTGATCCAGG - Intronic
1098193642 12:67976946-67976968 GCCTGGAACTTTAGTGAGACAGG - Intergenic
1100297403 12:93275621-93275643 AGCTGGAACCCAAGTGAGACAGG + Intergenic
1105741131 13:23324282-23324304 AATTGGAAATCTTGTGAGAATGG + Intronic
1107243410 13:38264773-38264795 GCGTGGAACTCCGGTGAGACAGG + Intergenic
1107314858 13:39120010-39120032 GCCTGGAACTCCAGTGAGGCAGG - Intergenic
1108510969 13:51155659-51155681 ACTTGGAAATATACTGAGAAAGG - Intergenic
1108871301 13:54989538-54989560 CCTGGGAAATCTAGAGAGACAGG - Intergenic
1110337251 13:74346709-74346731 GCCTGGAACTCCAGTGAGACAGG + Intergenic
1111259982 13:85724617-85724639 CCTGGGAATTCTAGTGAGGCAGG + Intergenic
1111736114 13:92141388-92141410 ACTTGGAAATATAGTGAGAGGGG + Intronic
1113400965 13:109992911-109992933 ACTTGGAACTGTGGTGGGAATGG - Intergenic
1114520302 14:23329955-23329977 CCATGGAACTCCAGTGAGATTGG - Intergenic
1115094130 14:29614441-29614463 ACTTATTACTCAAGTGAGACAGG - Intronic
1115614655 14:35083166-35083188 ACTAGTACCTCTAGGGAGACAGG - Exonic
1116984123 14:51202074-51202096 ATGTTGATCTCTAGTGAGACTGG + Intergenic
1118047383 14:61985763-61985785 AATTTGAACTCAATTGAGACTGG - Intergenic
1118634331 14:67734004-67734026 ACCTGACACTCTTGTGAGACTGG + Exonic
1119022972 14:71130535-71130557 ACTTTGAACTCCAGGAAGACAGG - Intergenic
1121569962 14:94940185-94940207 CATTGGAACTCCAGTGAGTCTGG + Intergenic
1121569970 14:94940236-94940258 CATTGGAACTCCAGTGAGTCTGG + Intergenic
1121569979 14:94940287-94940309 CATTGGAACTCCAGTGAGTCTGG + Intergenic
1123894253 15:24812538-24812560 ATTTGGAACTCTAAAGAGAAGGG + Intergenic
1124026262 15:25969019-25969041 ACTTGGAACACAAGTGATATGGG + Intergenic
1127999179 15:64175009-64175031 GCTTGGAACTCTAGTGGGGTGGG - Intronic
1128262588 15:66242873-66242895 ATTTGGAAATCTACTGAGAGAGG + Intronic
1129567077 15:76633982-76634004 TCTGGGAACTCAAGTGAGGCAGG - Intronic
1129958486 15:79661323-79661345 CCTTGGAAATCAAGTGAGTCAGG + Intergenic
1144431717 17:15198622-15198644 TCTGGGAACTCCAGTGACACAGG + Intergenic
1150104728 17:62454126-62454148 ACTTGGAAACTTAGTGAGAAAGG + Intergenic
1155926753 18:31663961-31663983 TGCTGGAACTCTAGTGAAACTGG - Intronic
1156084534 18:33382797-33382819 ACCTGGAACTCCAGTGAGACAGG + Intronic
1156230786 18:35152221-35152243 ACCTAGAACTCCAGTGAGACAGG - Intergenic
1156900957 18:42299796-42299818 ACTAGCAACTCTGGTGATACAGG + Intergenic
1158610264 18:58934170-58934192 AATTGGAACTCTGCTGAAACAGG + Intronic
1159220754 18:65460520-65460542 ATTTGGAACAATAGTGAGAGAGG + Intergenic
1159866034 18:73706104-73706126 ACTAGAAACACTGGTGAGACAGG - Intergenic
1161839785 19:6672713-6672735 ACATGGAAAACTAGAGAGACAGG + Intergenic
1162802860 19:13120510-13120532 CCTGGGAACTATAGGGAGACTGG - Intronic
1167077427 19:47257953-47257975 AGTTGGAACTCTCTTGAGATAGG + Intronic
926475396 2:13315041-13315063 ACCTGGAACTCCAGTGAGACAGG - Intergenic
928066227 2:28166963-28166985 ACTTGGAAATAGATTGAGACTGG + Intronic
930951303 2:57146690-57146712 ACCTGGAACTCCAGTGAGGCAGG + Intergenic
932547777 2:72732884-72732906 ACTGGGAAGTCTAAGGAGACAGG - Intronic
932801562 2:74746474-74746496 ACTTGGAAGTCTGGTCAGGCAGG - Intergenic
932944780 2:76215325-76215347 ACATTGAACTCTTGTGGGACAGG + Intergenic
933324209 2:80815257-80815279 GCTTGGAACTCCAGTGATACAGG + Intergenic
933743294 2:85551875-85551897 ACTTGGCCCTCCAGGGAGACAGG + Exonic
935489445 2:103698566-103698588 GCCTGGAACTCCAGTGAGGCAGG - Intergenic
935852224 2:107235439-107235461 GCCTGGAACGCCAGTGAGACAGG + Intergenic
936417416 2:112329632-112329654 ACATGGAACTTTAGTGTTACAGG - Intronic
937259132 2:120574264-120574286 ACCTGGAATTCTAGTGATGCTGG + Intergenic
938376010 2:130807195-130807217 GCTTGGCACTCCAGTGAGAAGGG + Intergenic
938568140 2:132539077-132539099 GCCTGGAACTCCCGTGAGACAGG - Intronic
939470630 2:142615833-142615855 ATCTGGAACCCCAGTGAGACAGG + Intergenic
939882063 2:147642079-147642101 ACTTGGAACTCTACCAAGATAGG + Intergenic
940075729 2:149739721-149739743 ACATGCCATTCTAGTGAGACAGG + Intergenic
941243458 2:163069474-163069496 AGTTGGCCCTCTAGTGAGTCGGG - Intergenic
941328940 2:164152912-164152934 ACTAGAAACTATAGTGAGTCAGG + Intergenic
944905227 2:204255592-204255614 ACTTGTCACTCTTGTGATACAGG - Intergenic
947156361 2:227165448-227165470 ACTTGGAATTTGAGTGAAACTGG + Intronic
947311601 2:228809352-228809374 GCCTGGAACTCCAGTGAGACAGG - Intergenic
949583336 3:5412648-5412670 ACCTGAAACACCAGTGAGACTGG + Intergenic
950141099 3:10616067-10616089 ACTTGGAACTGTAGTGGGATCGG - Intronic
959500483 3:107101312-107101334 ACTTGTAATTCAAATGAGACTGG + Intergenic
966041441 3:175494453-175494475 CCTAGGAACTCGAGTCAGACAGG - Intronic
970185398 4:13446383-13446405 ACCTGGAACTCCAGTGAGACAGG - Intronic
971137929 4:23890066-23890088 ACTGGGGACTGTAGTAAGACAGG - Exonic
972716069 4:41647417-41647439 ACTTGGTCCTCAAATGAGACAGG + Intronic
974298439 4:60034534-60034556 GTCTGGAACTCCAGTGAGACAGG - Intergenic
974814728 4:66989535-66989557 ACCTGGATCTCCAGTGAGACAGG - Intergenic
975213000 4:71722703-71722725 ATCTGGAACTCCAGTGAGACAGG - Intergenic
978839048 4:113187566-113187588 ACTTGGAACTTTAGCAACACAGG + Intronic
979409830 4:120363297-120363319 TCTTGGAACTGTAGAAAGACTGG + Intergenic
979957132 4:126968086-126968108 ACATGGAACGTGAGTGAGACGGG - Intergenic
980855199 4:138431548-138431570 ACCTGGAACTCCAGTGAGACAGG + Intergenic
982848125 4:160276672-160276694 ACCTGGAACTCCAATGAGACAGG + Intergenic
983570303 4:169200325-169200347 TGTTGGAACTCCATTGAGACTGG - Intronic
984230090 4:177085757-177085779 TCATGGATTTCTAGTGAGACTGG + Intergenic
986186878 5:5450845-5450867 TCTTGGAAATCTAGGGGGACTGG + Intronic
986944935 5:13005570-13005592 TCTTGGAAATCTGGAGAGACAGG - Intergenic
990291851 5:54360060-54360082 ACTTGGAACTATACTGGGAAGGG + Intergenic
992411820 5:76512585-76512607 AATTAGTACTATAGTGAGACTGG + Intronic
993365587 5:87030502-87030524 TCCTGGAACTCTAGTGAGGCAGG - Intergenic
995927196 5:117387950-117387972 ACCTGGGAGTCTAGAGAGACAGG + Intergenic
996592239 5:125160813-125160835 ACCCGGAACTCCAGTGAGACAGG + Intergenic
996631982 5:125643876-125643898 ATTTAGATCTCTAGTGAGGCTGG - Intergenic
997217879 5:132129450-132129472 ACCTGGAACCATAATGAGACAGG - Intergenic
998644581 5:144048196-144048218 GCCTGGAACTCCAGTGAGACAGG + Intergenic
1006208467 6:32371949-32371971 ACTTAGAACATTAGTGAGGCAGG + Intergenic
1013163058 6:107564735-107564757 ACTTGAAACTTCTGTGAGACTGG + Intronic
1013507885 6:110817238-110817260 ACTTGGAAAACTAGTGGGAGGGG + Intronic
1013948357 6:115750025-115750047 AGTTGGAACTCTCATCAGACAGG - Intergenic
1015420797 6:133005865-133005887 ACTCAGAACTGTAGTGAGAGTGG + Intergenic
1015517557 6:134099129-134099151 AGTTAGAAGTCTTGTGAGACTGG - Intergenic
1016883086 6:148930396-148930418 AGTTTAAAATCTAGTGAGACAGG + Intronic
1020557663 7:9690915-9690937 ACCTGGAACTCCAGTGAAATGGG + Intergenic
1028713170 7:93934269-93934291 ACTTGGTACTCCACTGAGTCTGG - Intergenic
1033711135 7:143946632-143946654 ATATGAAAATCTAGTGAGACAGG - Intergenic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1037770972 8:21799606-21799628 ACTGGGAATTCTAATGAGTCTGG - Intronic
1040697632 8:50021541-50021563 TCTGGGAACTCTAGTGGGTCTGG + Intronic
1042773592 8:72405242-72405264 ACCTGGAACTCCTGTGAGGCAGG + Intergenic
1049352168 8:142170235-142170257 ACATGGACACCTAGTGAGACTGG - Intergenic
1051298146 9:15618534-15618556 ACCTGGAACTCCAGTGAGAAAGG - Intronic
1055508410 9:76971020-76971042 ACTAGAAACTCTAGTTAGATAGG - Intergenic
1187692506 X:21883744-21883766 ACTTGGTAGTATAGTGAGAATGG + Exonic
1188915486 X:35904893-35904915 GCCTGGAACTCCAGCGAGACAGG - Intergenic
1190957411 X:55209047-55209069 ACTTAGACCTCAGGTGAGACTGG - Intronic
1190960342 X:55240774-55240796 TCTGGGAACTCCAGTGAGGCAGG + Intronic
1191185593 X:57607775-57607797 TCCTGGAACTCCAGTGAGGCAGG - Intergenic
1191766759 X:64706098-64706120 ACCTGGAACTCTAGGGAGACAGG - Intergenic
1192916083 X:75652489-75652511 ATCTGGAACTCCAGTGAGAAAGG - Intergenic
1193190405 X:78563769-78563791 GCCTGGAACTCCAGTGAGGCAGG - Intergenic
1194242533 X:91469908-91469930 GCCTGGAACCCCAGTGAGACAGG + Intergenic
1194445013 X:93976238-93976260 TCTGGGAACTTTAGTGAGGCAGG - Intergenic
1195435948 X:104843420-104843442 ACCTGGAACTCCAGCGAGACAGG - Intronic
1195772889 X:108371142-108371164 ACTACGAACTCTACTGAGACAGG + Intronic
1197319073 X:125005992-125006014 TCCTGGAACTCCAGTGAGACAGG + Intergenic
1197413896 X:126150988-126151010 ACCTAGAACTCTGGTGAGGCAGG - Intergenic
1199801185 X:151252842-151252864 ACCTGGAACTCCAGTGAGACAGG + Intergenic