ID: 1072857729

View in Genome Browser
Species Human (GRCh38)
Location 10:98967159-98967181
Sequence CAAAAAGCTGATATAGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072857728_1072857729 -6 Left 1072857728 10:98967142-98967164 CCATGAAGACTTAAGCTCAAAAA 0: 1
1: 0
2: 0
3: 18
4: 284
Right 1072857729 10:98967159-98967181 CAAAAAGCTGATATAGATAATGG No data
1072857727_1072857729 16 Left 1072857727 10:98967120-98967142 CCGAGCATTTAGCTGGCAGTTGC 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1072857729 10:98967159-98967181 CAAAAAGCTGATATAGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072857729 Original CRISPR CAAAAAGCTGATATAGATAA TGG Intronic
No off target data available for this crispr