ID: 1072866578

View in Genome Browser
Species Human (GRCh38)
Location 10:99068105-99068127
Sequence CAAAATGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072866578_1072866580 4 Left 1072866578 10:99068105-99068127 CCCATATCACTATCAGCATTTTG No data
Right 1072866580 10:99068132-99068154 AAGCCATTCAACAAGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072866578 Original CRISPR CAAAATGCTGATAGTGATAT GGG (reversed) Intronic