ID: 1072866642

View in Genome Browser
Species Human (GRCh38)
Location 10:99068849-99068871
Sequence ACCCAAGTTGTCTAATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 1, 2: 10, 3: 100, 4: 448}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072866642_1072866644 18 Left 1072866642 10:99068849-99068871 CCAATAAATTAGACAACTTGGGT 0: 1
1: 1
2: 10
3: 100
4: 448
Right 1072866644 10:99068890-99068912 GAAAGAAAAATTACCAAAACAGG No data
1072866642_1072866645 25 Left 1072866642 10:99068849-99068871 CCAATAAATTAGACAACTTGGGT 0: 1
1: 1
2: 10
3: 100
4: 448
Right 1072866645 10:99068897-99068919 AAATTACCAAAACAGGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072866642 Original CRISPR ACCCAAGTTGTCTAATTTAT TGG (reversed) Intronic
903752507 1:25635373-25635395 ATCTAAGTTGTAAAATTTATTGG + Intronic
904338666 1:29816019-29816041 ATCTAAGTTGTCCAATTTATTGG + Intergenic
904846098 1:33418471-33418493 ACCTAAGTTGTTTAAGTTATTGG - Intronic
905088226 1:35403933-35403955 ATCTAAGTTGTTTAATTTATTGG + Intronic
905493817 1:38367955-38367977 ATCTGAGTTGTCAAATTTATTGG + Intergenic
905949167 1:41932439-41932461 ACCTAAGTTGTCAAATTTATGGG + Intronic
906226163 1:44123382-44123404 ATCCAGGTTGTCCAATTTGTTGG + Intronic
907027968 1:51140736-51140758 ATCTAAGTTGTCTAATTTATTGG + Intronic
908805862 1:67931297-67931319 ACCTATGTCATCTAATTTATTGG + Intergenic
910514326 1:88041506-88041528 ATCTAAGTTGTCAAACTTATTGG - Intergenic
911935620 1:103966951-103966973 ATCTAAGTTTTCAAATTTATTGG + Intergenic
911975814 1:104493327-104493349 TTCCAGGTTGTCCAATTTATTGG - Intergenic
912234906 1:107839904-107839926 ACCTAAGTTATCAAATTTGTGGG - Intronic
912601421 1:110937940-110937962 TCTCAGGTTTTCTAATTTATTGG - Intergenic
913080562 1:115381574-115381596 ATCTAAGTTGTCAAATTTATTGG + Intergenic
913342612 1:117773941-117773963 ATCTAAGTTGTCAAATTTATTGG - Intergenic
913406484 1:118498072-118498094 ATCTAAGTTGTCTGATTTGTTGG - Intergenic
914218701 1:145657749-145657771 ATTGAAGTTGTCAAATTTATTGG + Intronic
914407189 1:147388241-147388263 ACCTAAGTTGTCTAATTTGTTGG + Intergenic
914471258 1:147980444-147980466 ATTGAAGTTGTCAAATTTATTGG + Intronic
915292173 1:154892813-154892835 ATATAAGTTGTCAAATTTATTGG - Intergenic
916672265 1:167032932-167032954 ATCCAAGTTCCCAAATTTATTGG - Intergenic
916910890 1:169345091-169345113 CTCTAAGTTGTCTAATTTAATGG + Intronic
917550570 1:176023385-176023407 TTCTAAGTTTTCTAATTTATTGG - Intronic
917894178 1:179471466-179471488 ATCCAAGTTATCTGATTTGTTGG + Intronic
918274065 1:182934170-182934192 ACCTAAGTTTTCAAATTAATTGG + Intronic
918790851 1:188826148-188826170 ATTTAAGTTGTCTAATTCATTGG + Intergenic
919030887 1:192241011-192241033 AACTAAGTTATCTAATTTATTGG - Intergenic
919097546 1:193056143-193056165 ATCTAAATTGTCAAATTTATTGG + Intronic
919238906 1:194886006-194886028 ATCAAATTTGTCTAATTTGTTGG - Intergenic
919618042 1:199831827-199831849 GTCAAAGTTGTCTAATTTGTTGG - Intergenic
920883867 1:209906414-209906436 ATCTAAGTTATCTAATGTATTGG + Intergenic
921471867 1:215559139-215559161 ATCTAAGTTGTCCAATGTATTGG + Intergenic
921928991 1:220738460-220738482 ACTGAAGTTTTCCAATTTATTGG + Intergenic
923964659 1:239123957-239123979 ACCCAGGTTGTCTGGTTTTTTGG - Intergenic
924027437 1:239849916-239849938 ACCCAGGTTGTCTTATTGAAAGG + Intronic
924319462 1:242833765-242833787 ATCTAAGATGTCAAATTTATTGG - Intergenic
924469493 1:244328607-244328629 ACCTAGGTTGTCAATTTTATTGG + Intergenic
924735842 1:246754706-246754728 ACCTAGGTTATCTAATTTGTTGG + Intronic
924745738 1:246832130-246832152 ATCTAAGTTATCTAATTTGTTGG - Intergenic
1063283213 10:4653900-4653922 AATGAAGTTGTCAAATTTATGGG - Intergenic
1063357895 10:5418406-5418428 ATCAAAGTTATCTAATTTGTTGG + Intronic
1063846882 10:10139281-10139303 AACTAAGTTGGCAAATTTATTGG - Intergenic
1065073293 10:22050346-22050368 TCCAAAGTTGTAAAATTTATTGG - Intergenic
1065161029 10:22921757-22921779 AGGTAAGTTGTCAAATTTATTGG - Intergenic
1065163738 10:22952414-22952436 ATCTAAGTTGTAGAATTTATTGG - Intronic
1065355150 10:24833676-24833698 ATCCAAGTCATCAAATTTATAGG + Intergenic
1066016731 10:31252768-31252790 ATCTAGGTTGTCTAATTTGTTGG + Intergenic
1066506011 10:36044597-36044619 ATCCAAGTGATCTAATTTATTGG + Intergenic
1067291111 10:44941891-44941913 ATCTAAGTTATCTAATTTGTTGG + Intergenic
1067729322 10:48798511-48798533 AACTAAGTTTTCTAATTTACTGG - Intronic
1068280369 10:54860795-54860817 ACCAACTTTGTCTAATATATTGG + Intronic
1068364186 10:56023810-56023832 ACCCAGATTTTCTTATTTATAGG + Intergenic
1068909397 10:62362527-62362549 ACCCAAATTGTCAAATTAATTGG - Intergenic
1069052265 10:63808424-63808446 ATCTAAGTTTTCCAATTTATGGG + Intergenic
1069125259 10:64622985-64623007 ACCTAACTTGTCAAATATATTGG - Intergenic
1069732564 10:70627484-70627506 ATCTAAATTGTCAAATTTATTGG - Intergenic
1069803520 10:71100444-71100466 ATCTAAGTTGTAAAATTTATTGG + Intergenic
1070062400 10:72996878-72996900 ATATAAGTTGTCAAATTTATTGG + Intergenic
1070270180 10:74946194-74946216 ATCTCTGTTGTCTAATTTATTGG + Intronic
1070414130 10:76173565-76173587 ATCCAAGTTGTCAAACTTATTGG - Intronic
1070443697 10:76472760-76472782 ATCCAAGTTATCTAATTCATTGG - Intronic
1070832585 10:79428857-79428879 ATCTAATTTGTCTAATTTGTTGG - Intronic
1071462061 10:85907416-85907438 ATCTAAGTTGTCAAATTTATAGG - Intronic
1071925093 10:90397398-90397420 ACATAACTTGTCTAATATATGGG - Intergenic
1072194329 10:93102630-93102652 ACCTAAGTTTTCAAGTTTATTGG + Intergenic
1072786088 10:98283561-98283583 ATCTAAGTTTTCAAATTTATAGG + Intergenic
1072866642 10:99068849-99068871 ACCCAAGTTGTCTAATTTATTGG - Intronic
1074474848 10:113762072-113762094 ACCTAAGTTGCCAAATTTATTGG + Intronic
1074672628 10:115810760-115810782 ATCTAAGTTGTCAAATTTATTGG + Intronic
1074879440 10:117642607-117642629 ATCTAAGTTGTCCAATTTTTAGG + Intergenic
1076801274 10:132830574-132830596 ATCTAAGTTGTTAAATTTATTGG + Intronic
1076939850 10:133596240-133596262 TTCCAAGTTGTCAAATTTATGGG + Intergenic
1077447840 11:2608374-2608396 ATCTAAGTTTTATAATTTATTGG + Intronic
1078871762 11:15352749-15352771 ACCTAAGCTGTAGAATTTATTGG + Intergenic
1078887066 11:15512145-15512167 TCCCAAGATGTCAAGTTTATTGG + Intergenic
1079275713 11:19035224-19035246 ATCCAAGTTATCAAATTTGTGGG - Intergenic
1079834259 11:25312391-25312413 ATTTAAGTTGTCAAATTTATTGG + Intergenic
1080395283 11:31884458-31884480 ACCCATGCTGTCTAATATAGTGG - Intronic
1080479661 11:32633376-32633398 TCATAAGTTGTCAAATTTATTGG - Intronic
1080689938 11:34548203-34548225 ACCAAAGTTGGATAATTTTTTGG + Intergenic
1081001889 11:37683942-37683964 TCCCAAGTTTTTTAATTTCTTGG - Intergenic
1081068158 11:38574849-38574871 ACCCAAGTTGACATTTTTATTGG + Intergenic
1081472258 11:43386020-43386042 ACCTAAGTTTTCAAATATATTGG - Intronic
1082859835 11:57844981-57845003 ATCTAAATTATCTAATTTATTGG - Intergenic
1084300055 11:68243324-68243346 ATCTAAGTTGTCAAATTTATTGG - Intergenic
1084984976 11:72861263-72861285 ATCTAAGTTGTCAGATTTATTGG - Intronic
1085594816 11:77799885-77799907 ATCCAGGTTATCTAATTTGTTGG - Intronic
1085613402 11:77974198-77974220 AACTAAGTTATCTAATTTATTGG + Intronic
1086272082 11:85079745-85079767 ACCTAAGCTGGCTAATTTGTTGG - Intronic
1086302339 11:85440863-85440885 ACCCAAATTATCTACTTCATAGG - Intronic
1086320546 11:85642687-85642709 ACCTAAGTTCTCAAGTTTATTGG - Intergenic
1086556977 11:88121917-88121939 ACCCATGTTTTCTAAGTTTTTGG + Intronic
1087277149 11:96171923-96171945 ACCAAAGTTGTCAGATTTAGGGG - Intronic
1087880808 11:103414282-103414304 ACCTAAGTTGTTGAATTTGTAGG - Intronic
1087952056 11:104233620-104233642 ATACAAGTTGTCAAGTTTATTGG + Intergenic
1088405593 11:109473661-109473683 ATCCAGGTTATCTAATTTATTGG - Intergenic
1088583733 11:111340009-111340031 ATCAAAGTTGTCAAATTTATTGG - Intergenic
1089421369 11:118333276-118333298 ACCCGAGTTGTGAAATTTATTGG - Intergenic
1091110885 11:132965472-132965494 ATCTAAGTTATCTAATTTATTGG + Intronic
1092609289 12:10154571-10154593 ATCTAAGTTGTTTAATTTATTGG - Intergenic
1092896349 12:13014533-13014555 ATCTAAATTGTCAAATTTATTGG + Intergenic
1093239378 12:16650831-16650853 ACCTAAGTTATCAAATTTGTGGG - Intergenic
1093544096 12:20325110-20325132 AATCAAGTTTTCAAATTTATTGG + Intergenic
1093952406 12:25178357-25178379 ATCTAAGTTTTCTAATATATTGG + Intronic
1094404633 12:30103468-30103490 ACCAAAATTATCTAATTTTTTGG + Intergenic
1095717416 12:45362253-45362275 ATCTAAGTTGTCTAATTAGTTGG + Intronic
1095756538 12:45773615-45773637 ATCTAAGTTATTTAATTTATTGG - Intronic
1097565035 12:61257385-61257407 ATCTTAGTTGTCTAATTTACTGG - Intergenic
1097992576 12:65851533-65851555 ACCACAGCTGTCTAATTTCTTGG - Intronic
1098198319 12:68026310-68026332 ATCAAAGTTGTCAAGTTTATTGG - Intergenic
1098520544 12:71431169-71431191 ACACAAGTTTTCTATTTTCTGGG - Intronic
1098743362 12:74202927-74202949 ATCCAAGTTGTCAAATTTACTGG + Intergenic
1098830640 12:75358205-75358227 ATCCAAGTGGTAAAATTTATTGG - Intronic
1099087705 12:78265976-78265998 ATCCAAGTTCTGTAACTTATTGG + Intergenic
1099121971 12:78701802-78701824 ACCTGAGTTGTCAAATTTACTGG + Intergenic
1099752441 12:86792982-86793004 ACCCAAGAAATCTAATTAATAGG + Intronic
1099891994 12:88600821-88600843 ATTCAAATTGTCGAATTTATAGG + Intergenic
1100369338 12:93952599-93952621 AGCTAAGTTGTCCAATTTACTGG - Intergenic
1100577201 12:95904133-95904155 ATCTAAGTTGTCAAATTTATTGG + Intronic
1101218732 12:102614199-102614221 ATCTAAGTTGTCAGATTTATAGG - Intergenic
1101374737 12:104161603-104161625 ACCTAAATTGTTGAATTTATTGG + Intergenic
1102069818 12:110009033-110009055 ATCTAAGTTGTCTAATTTGTTGG + Intronic
1104726547 12:131079736-131079758 ATCAAAGTTGTTTAATTTATAGG + Intronic
1105309931 13:19197580-19197602 ATCTAAGTTGTCCAGTTTATTGG + Intergenic
1105435749 13:20376727-20376749 AATTAAGTTATCTAATTTATTGG - Intergenic
1105527549 13:21189861-21189883 ATCTAAGTTGTCCAATTTATTGG - Intergenic
1105648325 13:22345960-22345982 TCCAATGTTGTCTAATGTATTGG - Intergenic
1107342920 13:39428459-39428481 ATCTAAGTTGTCAAATGTATTGG + Intronic
1107429218 13:40323961-40323983 AATTAAGTTGTCAAATTTATTGG + Intergenic
1108032488 13:46249505-46249527 ACCTAAGTTATTTAATTGATTGG - Intronic
1108105951 13:47009826-47009848 ATCTACGTTGTCAAATTTATTGG - Intergenic
1108489128 13:50962467-50962489 ATCTAGGTTGTCAAATTTATTGG + Intronic
1109812575 13:67533797-67533819 ATCCAAGTTATCTAATTTATGGG - Intergenic
1109961229 13:69634728-69634750 TCCCAGGTTTTCTAATTTATTGG + Intergenic
1110005913 13:70268805-70268827 ACTCAAATAGTCTGATTTATTGG - Intergenic
1110677004 13:78260460-78260482 ATCTAAGTTGTCATATTTATGGG - Intergenic
1111784045 13:92764830-92764852 CCCCAAATTGTCTAATTTTATGG + Intronic
1112418236 13:99223100-99223122 ATCTAAGTTATCAAATTTATGGG + Intronic
1112658388 13:101477703-101477725 TTCCAGGTTTTCTAATTTATTGG - Intronic
1113020544 13:105880748-105880770 ACCTAAATTGTCATATTTATTGG - Intergenic
1113631462 13:111888949-111888971 ATCTAAGTTATCTAATTCATTGG + Intergenic
1113705339 13:112427806-112427828 ACCTAAGTTGGCAAAGTTATTGG + Intronic
1115103306 14:29729428-29729450 ATTCAAGTTGTCAAATTTCTTGG + Intronic
1115635511 14:35287021-35287043 ACTCTAGTTCTATAATTTATGGG - Intronic
1115686459 14:35801621-35801643 ATCTAAGTTGTCAAATTTATAGG - Intronic
1115849148 14:37575037-37575059 ACACAAATTGTCTCATTTTTTGG + Intergenic
1116521854 14:45858346-45858368 ATCTAAGTTGTTGAATTTATTGG + Intergenic
1116754579 14:48930368-48930390 ATCTAGGTTGTCAAATTTATAGG - Intergenic
1116778453 14:49208913-49208935 ACCCAAGTTATCTTATTCAAGGG + Intergenic
1116987472 14:51236789-51236811 ATGTAAGTTGTCTAATTTGTTGG - Intergenic
1117976476 14:61302129-61302151 ATCTAAGTTGTTGAATTTATTGG + Intronic
1118409639 14:65465084-65465106 ACCTAAGTTATCAAATTTAAGGG + Intronic
1118585000 14:67344202-67344224 ACCCAAGTTGTCCTTTTCATTGG - Intronic
1119413180 14:74450097-74450119 ACCTAAGTTATTAAATTTATTGG - Intergenic
1119462105 14:74814981-74815003 ACCTAAATTATCTAATTTGTTGG + Intronic
1120724842 14:87927059-87927081 ATCTAAATTGTCTAATTTATTGG - Intronic
1121075488 14:91064799-91064821 ACCCAAGTTGACAAATTCAGTGG - Intronic
1121785127 14:96652860-96652882 ACCTAAATTGCCTAATTTATTGG + Intergenic
1122085900 14:99304555-99304577 ACCTAACTTGTTGAATTTATTGG - Intergenic
1122260059 14:100512359-100512381 ATCAAAGTTGTCCAATTTTTTGG + Intronic
1122431581 14:101652310-101652332 ATCCAATGTGTCTAATTTATTGG - Intergenic
1202892656 14_KI270722v1_random:174148-174170 ATCTAAGTTATCTAATATATTGG - Intergenic
1124434992 15:29640240-29640262 ACCTAAGTCATCTAATTTGTTGG - Intergenic
1125054851 15:35346407-35346429 ACCTAAGTTTTCAAGTTTATTGG + Intronic
1127209129 15:56753770-56753792 ATCTAAGTTGTCAGATTTATTGG + Intronic
1127218776 15:56854602-56854624 ACTGAAGTTGTCAAATTTATTGG - Intronic
1129496049 15:75981868-75981890 ATCCAGGTTTTCAAATTTATTGG - Intronic
1130700803 15:86178465-86178487 ATCTAAGTTGTCCAATTTATTGG - Intronic
1131104183 15:89719473-89719495 GTCTAAGTTGTCAAATTTATTGG + Intronic
1131741977 15:95402779-95402801 ACCTAATTTGTGTAATGTATGGG + Intergenic
1132166976 15:99602962-99602984 ATGTAAGTTGTCTAATTTATTGG + Intronic
1133915858 16:10109148-10109170 ATCTAGGTTGTCAAATTTATAGG - Intronic
1134421916 16:14100829-14100851 ATCTAAGTTGTTGAATTTATTGG + Intronic
1135558619 16:23457563-23457585 ATCCAAGTTGTATAATTTGTTGG + Intergenic
1135697147 16:24598808-24598830 ATCTAAGTTGTCAAATTTACTGG + Intergenic
1137018822 16:35402152-35402174 GCCCTAGTACTCTAATTTATGGG - Intergenic
1137325816 16:47435476-47435498 ATCAAAGTTTTCTAATTTGTGGG + Intronic
1137504407 16:49040564-49040586 AGCTAGGTTATCTAATTTATTGG + Intergenic
1137680407 16:50338320-50338342 ACCAAAGTTGTCTAAATATTAGG + Intronic
1139258473 16:65566926-65566948 TCCTAATTTGTCTATTTTATTGG - Intergenic
1139370473 16:66465855-66465877 ATCCAAGTTATCCAATTTGTTGG + Intronic
1140160336 16:72484616-72484638 AGCTAAGTTTTCAAATTTATTGG + Intergenic
1140162700 16:72514963-72514985 TCTCAAGTTGTATAATTTGTTGG + Intergenic
1140204906 16:72925705-72925727 CCAGAATTTGTCTAATTTATAGG + Intronic
1140943166 16:79741759-79741781 ATCCAAGTTATCTAATTTGTTGG - Intergenic
1141874929 16:86817530-86817552 ACCTAAGTTGTCAAATCTGTGGG + Intergenic
1142316378 16:89348707-89348729 ATCTCAGCTGTCTAATTTATTGG + Intronic
1142817963 17:2442743-2442765 ATCTAAGTTGTGAAATTTATTGG - Intronic
1143342255 17:6221100-6221122 ATCTAAGATGTCAAATTTATTGG - Intergenic
1143644951 17:8223993-8224015 ACCCCAGTTGTGTGATTTGTGGG + Intergenic
1143841654 17:9737020-9737042 ATCTAAGTTGTTCAATTTATTGG + Intergenic
1144158640 17:12534846-12534868 ACCCAAGGTTTCTAATGAATAGG + Intergenic
1144395542 17:14839272-14839294 CCTCAAGTTGGCTAATTTCTAGG - Intergenic
1145096201 17:20029682-20029704 ATCTAAGTTTTCTAATTTGTTGG + Intronic
1147148849 17:38501640-38501662 ACCTAAGTTATTGAATTTATGGG - Intronic
1150089429 17:62309706-62309728 ATCTAAGTTGTCTTATTTGTTGG + Intergenic
1150731092 17:67694550-67694572 ACCAAAGTTTTCTAAGTCATAGG + Intronic
1153258999 18:3203509-3203531 GTCTAAGTTGTCTAATTTGTTGG - Intronic
1153353769 18:4111699-4111721 ATCTAAGTTATCTAATTTGTGGG + Intronic
1153429129 18:4996380-4996402 ATCTAAGTTGTTGAATTTATTGG - Intergenic
1153605988 18:6833548-6833570 ACCCAACTTGTCTGATGTAGAGG - Intronic
1153799078 18:8652676-8652698 ATCTAAGTTGTTAAATTTATAGG - Intergenic
1155526926 18:26726117-26726139 ATCTAAGTTATCAAATTTATTGG + Intergenic
1155594115 18:27463020-27463042 ATCTAAGTTATCTAATTCATTGG - Intergenic
1155612988 18:27689567-27689589 ACCTAAATTTTCAAATTTATGGG + Intergenic
1155747920 18:29384063-29384085 ATTCAAGTTGTCTAATTTATTGG + Intergenic
1156138357 18:34073299-34073321 ATCTAATTTGCCTAATTTATTGG - Intronic
1156233337 18:35176435-35176457 ATCTAAGTTGTTGAATTTATTGG - Intergenic
1156311982 18:35932257-35932279 ATCCAAATTGACAAATTTATTGG - Intergenic
1156392851 18:36667317-36667339 ATCTAAGTTGTCAAAGTTATTGG - Intronic
1156392909 18:36668281-36668303 ATCTAAGTTGTCAAAGTTATTGG + Intronic
1156691939 18:39718495-39718517 TCTAAAGTTATCTAATTTATTGG + Intergenic
1157061631 18:44298580-44298602 ATCCAAACTGTCAAATTTATTGG - Intergenic
1157448039 18:47762027-47762049 ATCTAAGTTGTCAAATTTATTGG - Intergenic
1158223418 18:55173897-55173919 ATCTAAGTTGTTTAACTTATTGG - Intergenic
1160275287 18:77427066-77427088 ATCTAAGTTGTAAAATTTATGGG + Intergenic
1161441835 19:4296371-4296393 ATCCAGGTTGTATAATTTACAGG + Intronic
1164687965 19:30182452-30182474 ATGTAAGTTATCTAATTTATTGG - Intergenic
1164966993 19:32493820-32493842 ACCCAAGTTGTCTTACATAAAGG + Intergenic
1165673921 19:37705261-37705283 ATCTAAGTTGTCAAATTGATTGG - Intronic
1167445623 19:49535526-49535548 TCACAAGTTAGCTAATTTATTGG + Intronic
926464764 2:13174823-13174845 AACAAAGTTATCAAATTTATGGG + Intergenic
926620627 2:15043729-15043751 ACCCAGGTTTTCTAATTGCTGGG - Intergenic
928047137 2:27946854-27946876 ATCCAAGTTGTTGAAATTATTGG + Intronic
928119147 2:28569594-28569616 ATCCAAGTTATCTGATTTATTGG - Intronic
928609630 2:32978964-32978986 TCCTAGGTTTTCTAATTTATTGG + Intronic
929136762 2:38632010-38632032 ACCCAAGTCTCCTAATTTATGGG - Intergenic
929767181 2:44855319-44855341 ATCTAAGTTTTCTAATTTAATGG - Intergenic
929851587 2:45596102-45596124 AAGCAAGTTGTCTCATTTAAAGG - Intronic
929852233 2:45603061-45603083 ACCCTAGTTTTCTATTTCATTGG - Intronic
930182690 2:48379848-48379870 ACCGAAGTTGTTGAACTTATTGG - Intergenic
930253022 2:49057417-49057439 ATCCAGGTTTTCAAATTTATTGG - Intronic
930672759 2:54168911-54168933 ACCTCAGTTGTCTATTTTATAGG - Intronic
930959583 2:57243807-57243829 ATCTTAGTTATCTAATTTATTGG + Intergenic
931315835 2:61130286-61130308 ATCTAAGTTATCCAATTTATTGG - Intronic
932120360 2:69093715-69093737 ACCAGATTTGTCTATTTTATTGG - Intronic
932743486 2:74311069-74311091 ACCTAAGTTATCAAATTTGTAGG + Intronic
933214183 2:79608145-79608167 ACCTAAGTTGTCCAACTTATAGG - Intronic
933855238 2:86407131-86407153 ACCTAAGATATCTAATTTATTGG - Intergenic
933974342 2:87496402-87496424 AACCAAGTTGTAGAATTTAAAGG + Intergenic
934880741 2:97975502-97975524 ATCTAAGTTGTCAAATTAATTGG - Intronic
934982733 2:98858869-98858891 ATCTAGGTTGTCTAATTTTTTGG - Intronic
935004336 2:99056437-99056459 ATCCAAGATATTTAATTTATTGG - Intronic
935004465 2:99058672-99058694 ATCTAAGTTGTCAAATTTGTAGG - Intronic
935456696 2:103277549-103277571 ATCTAAGTTGTCCAATCTATGGG - Intergenic
935750552 2:106229587-106229609 ACCTAGGTTATCCAATTTATAGG + Intergenic
936120652 2:109740809-109740831 ACCTAGGTTATCCAATTTATAGG - Intergenic
936224045 2:110630651-110630673 ACCTAGGTTATCCAATTTATAGG + Intergenic
936272754 2:111063023-111063045 ATCTAAATTGTCAAATTTATGGG - Intronic
936319482 2:111454417-111454439 AACCAAGTTGTAGAATTTAAAGG - Intergenic
936408072 2:112226155-112226177 ATCTAAGTTGTCTACTTTGTTGG - Intronic
936965172 2:118120354-118120376 ACCCATGTTGCCTTAGTTATTGG - Intergenic
937351518 2:121166774-121166796 ACCTAAGCTGTTTAATTTATTGG + Intergenic
937806893 2:126156229-126156251 ATCCAAGTTATCAAATTTGTGGG + Intergenic
937899362 2:127005844-127005866 ATCTAAGTTGTTGAATTTATTGG - Intergenic
938180088 2:129174156-129174178 ATCTAAGTTGTTGAATTTATTGG - Intergenic
938255327 2:129854912-129854934 ACCTAGGTTATCTAATTTGTTGG - Intergenic
938767889 2:134473768-134473790 TTCTAAGTTGTCAAATTTATTGG - Intronic
938793537 2:134698340-134698362 ATCCAAGTCTTCAAATTTATGGG + Intronic
939655776 2:144822596-144822618 ATCAAAGTTGTATAATTTGTTGG - Intergenic
940109908 2:150140278-150140300 AGACAATTTGTATAATTTATTGG - Intergenic
940483388 2:154265178-154265200 ATCTAAGTTGTCAAGTTTATTGG - Intronic
940721662 2:157289181-157289203 ACCCATGTTGTCTAATAGTTTGG - Intronic
940920609 2:159301979-159302001 ACCTAAGTCATCTAATTTGTTGG + Intergenic
941038550 2:160594696-160594718 ATCTAAGTTATCTAATTTATTGG + Intergenic
941637828 2:167955138-167955160 ACTCAGGTGGTCTTATTTATTGG - Exonic
941821139 2:169844400-169844422 ATCTAAGTTGTTGAATTTATGGG + Intronic
942160266 2:173178259-173178281 ATCTAAATTATCTAATTTATTGG - Intronic
943013663 2:182483989-182484011 ATCTAAGTTGTCCAATTTTTTGG - Intronic
943940063 2:193981597-193981619 ACCTAAGTTGTCCAACTTTTAGG - Intergenic
944956384 2:204815289-204815311 ACCTAAGTTGTTGAATTTATTGG + Intronic
945378327 2:209107087-209107109 TCCTAAGTTTTCAAATTTATTGG - Intergenic
945718995 2:213394986-213395008 ATCCAAGTTGTTAAATTTATGGG + Intronic
948638527 2:239357989-239358011 ATCTAAGTTGTCAAATTTATTGG - Intronic
948923453 2:241078752-241078774 ACCCAAAGTGTACAATTTATTGG - Intronic
1169904423 20:10586784-10586806 ACCTTAGTTTTCAAATTTATTGG - Intronic
1170073164 20:12390715-12390737 ACCCAGGTTGCTGAATTTATGGG + Intergenic
1170133894 20:13052579-13052601 AACCAAGTGGTCTAATTCAGTGG + Intronic
1170378811 20:15733117-15733139 ATCTAAGTTGTCAAATTTGTGGG + Intronic
1170928820 20:20749855-20749877 ACCAAAGTTCCCTATTTTATGGG + Intergenic
1170992653 20:21318181-21318203 ATCTAAGTTATCTAATTTGTTGG + Intronic
1171402584 20:24886557-24886579 ATCTAAGTTATCTAATTTGTTGG - Intergenic
1171754106 20:29085436-29085458 ATCCAAGTTGTTGGATTTATTGG + Intergenic
1171859404 20:30382334-30382356 ATCCAAGTTGTTGGATTTATTGG + Intronic
1172326158 20:34036791-34036813 ACCCAAGTTGTCTAATTTGTTGG + Intronic
1172946773 20:38695478-38695500 GCAGAATTTGTCTAATTTATGGG - Intergenic
1173055426 20:39607577-39607599 ACCCAAGTTGTCTTTTTTCCAGG - Intergenic
1173411482 20:42814542-42814564 AACTTAGTTATCTAATTTATAGG + Intronic
1176928274 21:14777371-14777393 ATCTATGTTGTCAAATTTATTGG - Intergenic
1177107741 21:16980849-16980871 ATCTAAGTTGTAAAATTTATGGG - Intergenic
1178167471 21:29996375-29996397 ATCTAAGCTGTCAAATTTATTGG - Intergenic
1180031876 21:45216085-45216107 ATCTAATTTGTCTAATATATTGG + Intronic
1180111672 21:45658920-45658942 ACCTAGGTTATCTAATTTATTGG + Intronic
1180191343 21:46165117-46165139 ATCTAGGTTGTCAAATTTATTGG - Intronic
1180297507 22:10956296-10956318 ATCCAAGTTGTTGGATTTATTGG - Intergenic
1181748191 22:24970459-24970481 GCCCAGGTTGTATAATGTATTGG - Intronic
1181995224 22:26873505-26873527 ATTCAGGTTGTCAAATTTATTGG + Intergenic
1182154650 22:28058862-28058884 ATCTTAGTTGTCAAATTTATTGG + Intronic
1182500808 22:30745929-30745951 ATCCAGGTTATCTAATTTGTTGG - Intronic
1184435148 22:44468777-44468799 ATCTAAGTCATCTAATTTATTGG - Intergenic
1184543611 22:45149100-45149122 ACTCAAGGTCTCTAAATTATTGG + Intergenic
949236295 3:1813003-1813025 ACACAAATTGTGAAATTTATAGG - Intergenic
949470221 3:4387356-4387378 GCCTAAGTTGTCACATTTATGGG + Intronic
949609481 3:5689505-5689527 ATCCTAGTTGCCAAATTTATTGG + Intergenic
950561319 3:13728870-13728892 CTCTAAGTTGTCTAATTTGTTGG + Intergenic
950731878 3:14967118-14967140 ATCTAAGTTATCTAATTTGTTGG + Intronic
951897593 3:27625068-27625090 ACCCGGGTGGTCTGATTTATTGG + Intergenic
952372730 3:32738811-32738833 TTCTAAGTTGTCAAATTTATTGG + Intronic
952667466 3:35923579-35923601 ATCTAAGTTGTGTAATTTATAGG + Intergenic
953279826 3:41543670-41543692 ATCTAAGTTATCTAATTTATTGG + Intronic
953731458 3:45453102-45453124 AACCAAGTTTTTTATTTTATTGG + Intronic
955040345 3:55311207-55311229 ATCCAAGCTGTTGAATTTATTGG - Intergenic
955154597 3:56404422-56404444 ACCCAAGTTGCCTTTTTTGTAGG - Intronic
955173583 3:56589174-56589196 GCCCAAATTCTCTAACTTATTGG - Intronic
955583648 3:60452395-60452417 ACCCAAGATGACTAAATTATTGG + Intronic
957006448 3:74953717-74953739 ATCTAAGTGGTCAAATTTATGGG - Intergenic
958044994 3:88273332-88273354 ATTTAAGTTGTCAAATTTATAGG + Intergenic
958674371 3:97248609-97248631 AAGCAAGTTGTCCAATTCATTGG + Intronic
959076778 3:101757228-101757250 CTCCAAGTTGTTTAATTTGTCGG + Intronic
959877160 3:111396915-111396937 ACATAAGTTGTCAAATTTGTCGG + Intronic
960062308 3:113336441-113336463 ATCTAAGTTGTCAATTTTATTGG - Intronic
960499700 3:118422102-118422124 ATCAAAGTTGTCTAATTTGTGGG - Intergenic
960613396 3:119575278-119575300 ACCCAAGTGATCTCATTTTTCGG - Intergenic
961759416 3:129154524-129154546 ATCTAAGTTGTCAAATTTATGGG + Intronic
962125829 3:132616621-132616643 ACCCAATTTGTAGAATATATAGG - Intronic
962326584 3:134439445-134439467 ATCTAAGTTGTCAAATTTATTGG + Intergenic
962359137 3:134722233-134722255 ATCCAAGTTATCTAATTTGTTGG + Intronic
962639335 3:137367892-137367914 ATCAAAGTTGTCAAATTCATAGG + Intergenic
962966648 3:140360731-140360753 ATCAAAATTGTTTAATTTATTGG - Intronic
966456312 3:180120112-180120134 ATCTAAGTTGTTGAATTTATGGG + Intergenic
966685905 3:182695049-182695071 ACTTAAATTGTCAAATTTATTGG - Intergenic
967206235 3:187124833-187124855 GCCCCAGTGGTCTAATTTAATGG - Intronic
967305707 3:188057105-188057127 AACCAAGATGCCTAATTTGTTGG + Intergenic
967670530 3:192229096-192229118 ACCTAAGTTGTCTAACTTCTGGG + Intronic
968743879 4:2348190-2348212 ATCTAAGTTGTTGAATTTATTGG - Intronic
969434326 4:7177169-7177191 ATCTAAGTTGTCTAATTTGTTGG + Intergenic
970628775 4:17919130-17919152 ATCTAGGTTATCTAATTTATTGG - Intronic
971099289 4:23445295-23445317 ACCCAAATTGGGTAATTTAAAGG - Intergenic
972283080 4:37621851-37621873 ACCCATGTTGTCTAAACTCTGGG + Intronic
974138057 4:57844779-57844801 ACCCATGTTGTTGCATTTATTGG - Intergenic
974761923 4:66287386-66287408 AGCCAAATTGTCAATTTTATTGG + Intergenic
975793065 4:77976095-77976117 ATCTAAGTTGTCAAAATTATTGG + Intergenic
975873444 4:78807680-78807702 ACCCAAGATATCTAATTTGTTGG + Intronic
977193035 4:94023969-94023991 ACCTAGGTTATCTAATTTATTGG - Intergenic
977416488 4:96740115-96740137 ATCTAAGTTGTCAAATTTATTGG - Intergenic
977739773 4:100465132-100465154 ATCTAAGTTGTCTAATTTTTTGG + Intronic
979312906 4:119225175-119225197 CACCTAGTTGTCAAATTTATTGG - Intronic
979355845 4:119704450-119704472 ATCCAAATTATCAAATTTATTGG - Intergenic
979369024 4:119861613-119861635 TCCCAAGTTGTCAAACTTACTGG - Intergenic
979542048 4:121895567-121895589 TCCCAGGTTTTCTAATTTATTGG - Intronic
980740484 4:136944210-136944232 AGCCAAGTTATTTAATTTCTGGG - Intergenic
981499396 4:145433469-145433491 CTCTAAGTTGTCAAATTTATTGG + Intergenic
981867910 4:149448712-149448734 ATCAAAGTTGTTGAATTTATTGG - Intergenic
981904015 4:149899156-149899178 ATCCAAGTTGTCACATTTATTGG + Intergenic
983165139 4:164467059-164467081 ACCCAAGCTTTCTTATTTAAAGG + Intergenic
983498106 4:168467549-168467571 ATCTAAGTTGTCTAATGTTTTGG - Intronic
984147812 4:176085563-176085585 ATCCAAGTTATCCAATATATTGG + Intronic
985143579 4:186868694-186868716 ATCAAAGTTATCCAATTTATTGG + Intergenic
985872985 5:2572558-2572580 ACCTAAGTTTTTGAATTTATTGG - Intergenic
986109338 5:4696040-4696062 ATCCAAGTTGTTGAATTTGTTGG - Intergenic
988094615 5:26588383-26588405 ATCCAATTTATCAAATTTATAGG + Intergenic
988636781 5:32993373-32993395 ACCTAAGTTGTTTAATGTTTTGG + Intergenic
989361121 5:40602376-40602398 ACACAAATTGTCTAATTTCAAGG - Intergenic
990108787 5:52296708-52296730 ATCTAAGTTTTCCAATTTATTGG - Intergenic
990351089 5:54917332-54917354 ACCTAGGTTATCTAATTTGTTGG + Intergenic
990564534 5:57016140-57016162 ATCTAAGTTGTTCAATTTATTGG - Intergenic
991267239 5:64735623-64735645 ATCTAAGTTATCCAATTTATTGG + Intronic
991309521 5:65220976-65220998 AACAAAGTTTTCAAATTTATTGG - Intronic
991430962 5:66545365-66545387 ATCTAAGTTGTCAAAATTATTGG + Intergenic
991942861 5:71870400-71870422 AACCAAGTTGTCAAATGTATTGG - Intergenic
992586619 5:78246604-78246626 AACAAAGTAGTCAAATTTATGGG + Intronic
992725265 5:79600536-79600558 TTCCAAGTTTTCTAACTTATTGG + Intergenic
993204130 5:84858456-84858478 ATCTAAGTTATCTAATTTGTTGG + Intergenic
993284901 5:85981502-85981524 ATCTAAGTTTTCTAATGTATAGG + Intergenic
993797829 5:92290940-92290962 ACCCAAGTTATCGAATTTATGGG + Intergenic
994558935 5:101342292-101342314 TCCTAAGTTATCTAATTTGTTGG - Intergenic
994708691 5:103238674-103238696 TTCCAAGTTGTCAAATGTATTGG - Intergenic
994868641 5:105314982-105315004 ATCTAAGTTATCTAATTTTTTGG + Intergenic
995636337 5:114196614-114196636 ATCTAAGTTATCTAATTTGTTGG + Intergenic
995755141 5:115495136-115495158 ACCAAAGCTGTCTAATTTTAGGG + Intergenic
996142867 5:119934926-119934948 ATCTAAGTTGTCACATTTATTGG + Intergenic
996269592 5:121587144-121587166 ACTTAAGTTGTCAAATTTATTGG - Intergenic
996686416 5:126286282-126286304 ACCTAAGTTGTCAAATTTATGGG - Intergenic
996813675 5:127548970-127548992 ACCTAATTTTTCTAATTTATTGG - Intronic
996960476 5:129242338-129242360 GCCCAAGTTGAATGATTTATGGG + Intergenic
997268377 5:132513722-132513744 ATCTAAGTTATCTAATTTTTTGG - Intergenic
997290508 5:132730107-132730129 ATCTAAGTTGTCAAATTCATTGG - Intronic
997373531 5:133380417-133380439 ATCAAAGTTGTCTAATTTATTGG - Intronic
998255392 5:140583008-140583030 ATCTAAGTTCTCTAATTTGTTGG - Intronic
1000212892 5:159124531-159124553 ATCTAAGTTGTCTAATTTGTTGG + Intergenic
1000265976 5:159638030-159638052 ATCTAAGTTATCTAATTTATTGG - Intergenic
1001887525 5:175308706-175308728 ACCTAAGTTGTATAATTTTTTGG - Intergenic
1002308621 5:178299408-178299430 ACCTATGTTATCTAATTTGTAGG + Intronic
1003229510 6:4239234-4239256 ATCTAAGTTGTCAAATGTATTGG + Intergenic
1004766695 6:18736945-18736967 ATCTAAGTTTTCAAATTTATTGG - Intergenic
1005007447 6:21302398-21302420 ATCTAAGTTGTCTAATTTATTGG - Intergenic
1005180626 6:23101247-23101269 ATCTAAGTTACCTAATTTATTGG + Intergenic
1005180767 6:23103766-23103788 ATCTAAGTTACCTAATTTATTGG + Intergenic
1005372383 6:25148347-25148369 ACCTAAATTATCTAATTTGTTGG - Intergenic
1005714413 6:28533432-28533454 ACTCAACTCGTCTAACTTATAGG + Intronic
1005861054 6:29901086-29901108 ATCCAAGTGGTCTAACTTATTGG - Intergenic
1007920424 6:45604601-45604623 AACTAAATTGTCTAATTTGTTGG - Intronic
1008531315 6:52462961-52462983 ACCTAAGTTTTTAAATTTATTGG - Intronic
1008538179 6:52523803-52523825 ACCCATGTTGTTTTATCTATAGG + Intronic
1009058667 6:58371266-58371288 ACCTAAGTTATCCAATGTATTGG - Intergenic
1009714587 6:67373997-67374019 TTTGAAGTTGTCTAATTTATTGG + Intergenic
1009813376 6:68699228-68699250 ACCCATCTGGTCAAATTTATTGG - Intronic
1011464546 6:87642035-87642057 TCCCAAGTGCTCTAATTCATAGG - Intronic
1011541029 6:88429161-88429183 CATTAAGTTGTCTAATTTATTGG + Intergenic
1012186882 6:96228470-96228492 ATCTCAGTTGTCAAATTTATTGG - Intergenic
1012586082 6:100924191-100924213 ATCTGAGTTGTCTAATTTATTGG - Intergenic
1012874209 6:104706909-104706931 ATCTAAGTTATCTAATTTATTGG - Intergenic
1013181850 6:107723548-107723570 ATCTAAGTTATCTAATTTACTGG - Intronic
1013278741 6:108613491-108613513 ATTTAAGTTGTCTAATTTATGGG + Intronic
1013384515 6:109611865-109611887 ACCCAAGTACTCTATTTTAATGG - Intronic
1014131466 6:117839161-117839183 AAGCAAGTTGTCAACTTTATAGG + Intergenic
1014154808 6:118098251-118098273 ACCCAGGTTGTCTTAATTGTAGG - Intronic
1014297172 6:119633472-119633494 ACTTAAGTTGTTAAATTTATTGG - Intergenic
1014358360 6:120441244-120441266 ATCTAAATTGTCAAATTTATGGG - Intergenic
1014386490 6:120808896-120808918 ACATAAGTTGTCAAATTCATTGG - Intergenic
1014860646 6:126463677-126463699 ATTGAAGTTGTCTAACTTATTGG - Intergenic
1015314859 6:131806907-131806929 TCCCAAGTTGACTATTTTAAAGG + Intergenic
1015762190 6:136675980-136676002 ACCCATGTTGTTATATTTATTGG - Intronic
1015838754 6:137452865-137452887 ACCCAGGTTGTCTTATTCAATGG - Intergenic
1016161622 6:140887949-140887971 ACCTAAGTTGTCAAATGTCTGGG + Intergenic
1016200187 6:141396459-141396481 ACTTAAGTTGCCTAATTTGTTGG - Intergenic
1017614894 6:156235906-156235928 GACCAAGTTTTCAAATTTATTGG - Intergenic
1017677873 6:156833008-156833030 ACCCAAGTAGACTAGTTTTTAGG - Intronic
1017972053 6:159321108-159321130 ATCTAAGTTTTCAAATTTATTGG - Intergenic
1018004378 6:159607129-159607151 ATCTAAGTTGTCAAATTTATTGG + Intergenic
1018293727 6:162321250-162321272 ATCTAAGTTGCCAAATTTATAGG - Intronic
1018296324 6:162348985-162349007 ATCCAAGTAGTCAAATTTACTGG - Intronic
1018408309 6:163511579-163511601 AACTAAGTTGTCTAATTTACTGG - Intronic
1018586220 6:165362439-165362461 AACTAACTTGTCTACTTTATTGG - Intronic
1019161729 6:170073346-170073368 AACTAAGTTGTTTAACTTATTGG + Intergenic
1019782406 7:2951030-2951052 ATCTAAGTTATCTAATTTATTGG + Intronic
1021823696 7:24524996-24525018 ATCTAAGTTGTTGAATTTATTGG - Intergenic
1024769582 7:52704472-52704494 AACTAAGTTGTTTAATTTCTAGG - Intergenic
1025013523 7:55419303-55419325 ATCTAAGTTGTCAAATTTATTGG + Intronic
1025922955 7:65931473-65931495 ATCTAAGTTGTCAAATTTATGGG + Intronic
1025969134 7:66305866-66305888 ACTTAAGTTGTCAAATTTGTTGG + Intronic
1026163038 7:67887439-67887461 ACTTAAGTTATCTAATTTTTTGG + Intergenic
1026276582 7:68883467-68883489 ATCAAAGTTGTCAAATTTATTGG + Intergenic
1026363160 7:69621544-69621566 ACCCAGGTTTTCTAATATTTAGG + Intronic
1026393284 7:69925040-69925062 ATCAAAGTTGTTGAATTTATTGG + Intronic
1027476981 7:78644992-78645014 ATCTAAGTTGTCAAATATATTGG - Intronic
1027801516 7:82757108-82757130 ACCCCAGTTTTCTTATCTATAGG - Exonic
1028428959 7:90724197-90724219 ATCTAAGTTGTGGAATTTATTGG + Intronic
1028591066 7:92495567-92495589 ACCTAAGTTTTCAAATGTATTGG + Intronic
1028901779 7:96108980-96109002 ATCCATGTTGTTTCATTTATTGG + Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1029516617 7:101027494-101027516 ATCTAAGTTGTCAAATTTATTGG + Intronic
1030356096 7:108543987-108544009 ATCTAAGTTGTCAAATTTATTGG - Intronic
1030604205 7:111621995-111622017 AAGCAATTTGTCTCATTTATAGG + Intergenic
1030795868 7:113787351-113787373 AACAAAGTTGTCTAATTTACTGG - Intergenic
1031046538 7:116894703-116894725 ACCTAGGTTGTCAAATTCATAGG - Intronic
1031093239 7:117388033-117388055 ATCTAAACTGTCTAATTTATTGG - Intronic
1031223470 7:119003349-119003371 ATCTAAGTTATTTAATTTATTGG + Intergenic
1033364215 7:140659155-140659177 ACCCAACCTGTATAATTTAATGG + Intronic
1033680611 7:143591819-143591841 ATCTAAATTGTCAAATTTATTGG - Intergenic
1033704282 7:143869993-143870015 ATCTAAATTGTCAAATTTATTGG + Intronic
1034582341 7:152056143-152056165 ATCCAAGTTGTCACATTTATCGG + Intronic
1035089924 7:156300793-156300815 ATCTAAGTTGTCCAATTTCTTGG - Intergenic
1035119739 7:156556806-156556828 GCCCAACTTGTCTAATCTAAGGG - Intergenic
1035326030 7:158066712-158066734 ACCCAGATTGTATACTTTATGGG + Intronic
1035915255 8:3613142-3613164 ATCTAAGTTGTCAAATTTGTTGG - Intronic
1037500894 8:19484645-19484667 ACCAAAGTTGGCCAATTTGTGGG + Intronic
1037537405 8:19837980-19838002 ATCTAAGTTGTTAAATTTATTGG - Intronic
1037854763 8:22363652-22363674 AGCTAAGTTGTCTAATTTTTTGG - Intergenic
1037976291 8:23215662-23215684 ATCCAAGTTGTCAAATTGATTGG + Intronic
1038207786 8:25484425-25484447 ACCTAAGTTGTTAAATTCATTGG - Intronic
1038317193 8:26496560-26496582 ATCGAAGTTGCCTAATTTATTGG - Intronic
1038600255 8:28933678-28933700 ATCAAAGTTGTCAAATTTACAGG - Intronic
1039296528 8:36161938-36161960 ATCTAAGGTGTCAAATTTATTGG + Intergenic
1039639019 8:39198700-39198722 ACCCAAATTATCTAATGTAAAGG - Intronic
1040852677 8:51917642-51917664 ACCTAGGTTATCTAATTTATTGG + Intergenic
1041199826 8:55442199-55442221 AACCAAGTTTTCAAATTTTTAGG - Intronic
1041925654 8:63233695-63233717 ATCTAAGTTATCAAATTTATGGG - Intergenic
1042637716 8:70896449-70896471 ACATAAGTTGTTAAATTTATGGG + Intergenic
1043282650 8:78487650-78487672 ACACAAGTTATTTAATTTCTTGG - Intergenic
1043379749 8:79689796-79689818 ACCCAAGTTGTCTGAGGTACGGG + Intergenic
1043501138 8:80858017-80858039 ATCCAAGTTTTCAAATTTACAGG + Intronic
1043651492 8:82599656-82599678 AGCTAGGTTTTCTAATTTATTGG + Intergenic
1043710933 8:83418486-83418508 ACCTAAGTTATCAAATTTGTGGG + Intergenic
1044177221 8:89142262-89142284 ATCCAAATTCTCGAATTTATTGG + Intergenic
1044620111 8:94182011-94182033 ATCTAGGTTGTCTAATTTGTGGG - Intronic
1045184265 8:99820332-99820354 ATCCAAGTTATCAAATTTAATGG - Intronic
1045793636 8:106017221-106017243 ATCTGAGTTGTCAAATTTATAGG - Intergenic
1046403111 8:113733547-113733569 ATCTAAGTTTTCTAATTTGTTGG + Intergenic
1046963102 8:120130683-120130705 ATCCAGGCTTTCTAATTTATTGG - Intronic
1047918238 8:129605313-129605335 ATGCAAATTGTATAATTTATTGG + Intergenic
1049382113 8:142321684-142321706 ATCTTAGTTGTCAAATTTATGGG - Intronic
1049842475 8:144782021-144782043 CCCCAAGTTGTGTATTTTTTAGG - Intronic
1050322354 9:4466184-4466206 ATCTAAGTTGTCAAATTTATTGG - Intergenic
1050985003 9:12071224-12071246 ACCTAAGTTATCAGATTTATGGG + Intergenic
1051134671 9:13905781-13905803 ATCTAAGTTGTCAAATTTATTGG - Intergenic
1051644837 9:19257767-19257789 ATCTAAGTTGTCAAATTTATTGG - Intronic
1052508812 9:29388266-29388288 ATCTAAGTTTTCTAATTTGTTGG + Intergenic
1052761137 9:32592750-32592772 ATCCAAATTGTTGAATTTATTGG - Intergenic
1053508159 9:38663641-38663663 ATCTAAGTTGTACAATTTATGGG - Intergenic
1053725647 9:40997441-40997463 ATCCAAGTTGTTGGATTTATTGG + Intergenic
1054340289 9:63854434-63854456 ATCCAAGTTGTTGGATTTATTGG - Intergenic
1054897663 9:70332036-70332058 ATCAAAGTTGTCAAATTTATTGG - Intronic
1055122155 9:72673650-72673672 ATCTAAGTTGTCAAATTTATTGG - Intronic
1056385159 9:86090690-86090712 AGCCAAGTGGTCTAACTCATTGG - Intronic
1056669153 9:88608842-88608864 ATCTAAATTGTCTAATTTGTTGG + Intergenic
1057013165 9:91625718-91625740 ATCTAAGTTATCTAATTTGTTGG + Intronic
1057127216 9:92627097-92627119 ATCTAAGTTTTCTAATTTATTGG - Intronic
1057345876 9:94250178-94250200 ATCTAAGTTGTCTAATTTGTTGG - Intergenic
1058008317 9:99944073-99944095 ATCTAAGTTTTCTAATTTATTGG + Intronic
1058666901 9:107327000-107327022 ATCTAAGCTGTCTAATTTGTTGG + Intronic
1058726444 9:107809162-107809184 ACCCCAGTTGGGAAATTTATTGG + Intergenic
1059463937 9:114453623-114453645 ATCCAAGTTGTGGAATTTAAAGG - Intronic
1060703226 9:125777839-125777861 TTCCAAGTTATCTAATTTGTTGG + Intronic
1061827604 9:133270809-133270831 ACCTAAGTTGCATAATTTGTTGG - Intronic
1062608693 9:137361962-137361984 ATCTAAGTTGTCAAACTTATTGG - Intronic
1203449164 Un_GL000219v1:94526-94548 ATCCAAGTTGTTGGATTTATTGG - Intergenic
1187351996 X:18527492-18527514 ATCTAAGTTGTCAAATTTTTAGG + Intronic
1187435938 X:19269222-19269244 ATCTCAGTTGTCTAATTTATTGG - Intergenic
1188261342 X:28028284-28028306 ATCTAGGTTATCTAATTTATTGG + Intergenic
1188654585 X:32675992-32676014 ACCCAAGTTTTCCAATTTCTGGG - Intronic
1188872093 X:35385120-35385142 AACTAAGTTGTCAAATTTATTGG + Intergenic
1189082048 X:37984361-37984383 ATCTAAGTTATCTAATTTATTGG - Intronic
1189160880 X:38806734-38806756 AACCAATTTGGCTAACTTATTGG + Intergenic
1189502112 X:41571421-41571443 ATCTAAGTTGTTGAATTTATTGG + Intronic
1189925001 X:45943826-45943848 ATCTAAGTTGTCTAATTTATGGG + Intergenic
1190500389 X:51071049-51071071 ATCCAGGTTATCTAATTTGTTGG - Intergenic
1190706457 X:53032234-53032256 ATCTAAGTTGTCAAATTTACAGG - Intergenic
1190989748 X:55534839-55534861 ATGTAAGTTGTGTAATTTATTGG + Intergenic
1191691767 X:63946664-63946686 ATCAAAGTTGTCAAATCTATTGG + Intergenic
1191692177 X:63951955-63951977 ATCTAAGTTATCTAATTTGTTGG + Intergenic
1191806491 X:65140830-65140852 TTCCAGGTTGTCTAATTTGTTGG + Intergenic
1192354875 X:70392440-70392462 ATCTAAGTTGTCAAATGTATTGG + Intronic
1192773924 X:74222315-74222337 CACCAATGTGTCTAATTTATAGG - Intergenic
1192855668 X:75008415-75008437 ATCCAGATTGTCCAATTTATTGG + Intergenic
1193170157 X:78326814-78326836 ACCTACCTTGTCTAAATTATAGG + Intronic
1193284639 X:79697237-79697259 AGCCAAGTTGTCTAGTTCAGTGG - Intergenic
1193518966 X:82505655-82505677 ATCTAAGTTATCTAACTTATTGG + Intergenic
1193864020 X:86707212-86707234 ATCCAAGTTATCAAATTTGTGGG - Intronic
1194612915 X:96065190-96065212 TTCCAAATTATCTAATTTATTGG + Intergenic
1194759626 X:97779777-97779799 TCCTAAGTTGTCAAATGTATTGG - Intergenic
1194825545 X:98558533-98558555 ATCGAAGTTGTAGAATTTATTGG + Intergenic
1195030454 X:100922712-100922734 ACCCAAGCTGTCTAATAAACTGG - Intronic
1195309702 X:103619799-103619821 ATCTAAGTTATGTAATTTATTGG - Intronic
1195658734 X:107358006-107358028 ACCTAAGTTATCAAATTTGTGGG - Intergenic
1195793114 X:108611537-108611559 ATCTAAGTTGTCAAATGTATGGG - Intronic
1195971300 X:110476796-110476818 ACCTATGTTATCGAATTTATTGG - Intergenic
1196630144 X:117929063-117929085 AACTGAGTTGTCAAATTTATTGG - Intronic
1197711224 X:129670413-129670435 ATCTAAGTTGTCAAATTTACTGG + Intergenic
1198195719 X:134359519-134359541 ATCTAAGTTATCTAATTTGTTGG - Intergenic
1198360989 X:135894421-135894443 ACCTAAGTTGTTTAGTTTGTTGG + Intronic
1198586715 X:138129424-138129446 CCCGAAGTAGCCTAATTTATGGG - Intergenic
1198600142 X:138274897-138274919 ACCTAAGTTGTTAAAATTATTGG - Intergenic
1198625048 X:138561837-138561859 ATCTTATTTGTCTAATTTATTGG + Intergenic
1199311219 X:146321913-146321935 ATCTAAGTTGTTGAATTTATTGG - Intergenic
1199667365 X:150108806-150108828 ATCCAAGTTGTCAAATTTGTTGG + Intergenic
1200271094 X:154684446-154684468 ACAAAAGTTTTCAAATTTATTGG + Intronic
1200999373 Y:9460210-9460232 ACCTAAGTTTTCAAATTTGTAGG + Intergenic
1201002027 Y:9480521-9480543 ACCTAAGTTTTCAAATTTGTAGG + Intronic