ID: 1072868523

View in Genome Browser
Species Human (GRCh38)
Location 10:99090376-99090398
Sequence TTCGTTCAGAACATATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 1, 2: 7, 3: 61, 4: 430}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072868523 Original CRISPR TTCGTTCAGAACATATTTAT TGG (reversed) Intronic
901690411 1:10969592-10969614 TTCATTCAACAAATATTTATTGG + Intronic
902186978 1:14732916-14732938 TTCATTCAGAAAATACCTATCGG - Intronic
903312759 1:22472702-22472724 TCAGTTCAGCATATATTTATTGG + Intronic
903988245 1:27245319-27245341 TTCATTCAGCAAATATTTATTGG + Intronic
904252565 1:29235718-29235740 TTCATTCAACAAATATTTATTGG - Intergenic
904390306 1:30180840-30180862 TTCATTCAGCAGATATTTTTTGG - Intergenic
904581815 1:31549249-31549271 TTCGTTCAATAAATATTTCTTGG + Intergenic
905409375 1:37757730-37757752 TTCATTCAGCAAATATTTTTTGG + Intronic
906343709 1:45002525-45002547 TTCCTTCAGAATGTGTTTATTGG - Exonic
906673441 1:47676647-47676669 TTCATTTAGAACAAATGTATGGG - Intergenic
908045199 1:60161281-60161303 TTCTTTAAGAAGAGATTTATAGG + Intergenic
908732345 1:67238997-67239019 TTCCTTCAGCAAATGTTTATTGG - Intronic
909267739 1:73582588-73582610 TTCATTCAATAGATATTTATTGG - Intergenic
909772317 1:79439570-79439592 TTTATTCAGCAAATATTTATTGG - Intergenic
910038238 1:82814748-82814770 TTGATTCAGTAAATATTTATTGG - Intergenic
910278606 1:85474214-85474236 TTAGTCCAGAAAATAATTATTGG + Intronic
911870984 1:103098571-103098593 TTCATTCAAAAAATATTTACTGG + Intronic
912160491 1:106978553-106978575 TGCTTTCAGAACATGTTTCTTGG + Intergenic
912331370 1:108823079-108823101 TTTGTTCAGCAAACATTTATGGG + Intronic
912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG + Intergenic
913109667 1:115646656-115646678 TTCATTCAGCAGACATTTATAGG + Intronic
914959109 1:152190241-152190263 TTCATTCAACAAATATTTATTGG + Intergenic
916277470 1:163010349-163010371 TTCCTTCCCCACATATTTATCGG + Intergenic
917326218 1:173835401-173835423 TTCTTTAAGAACAAATCTATTGG + Intronic
918678579 1:187322178-187322200 TTCATTCAGCAAATATTTACTGG - Intergenic
918900446 1:190409683-190409705 TTTGTGCAATACATATTTATTGG + Intronic
919827011 1:201510248-201510270 TTCACTCAGAAGACATTTATTGG + Intergenic
920058693 1:203212829-203212851 TTCATTCAGTAACTATTTATTGG + Intronic
921572265 1:216793858-216793880 TTCATTCAGAAAATGGTTATTGG - Intronic
921717300 1:218430858-218430880 TTCCTTTAGACCATATTTAAAGG - Intronic
923228799 1:231964208-231964230 TTCATTCAATACATGTTTATTGG - Intronic
923452953 1:234136963-234136985 TTCATTCTGCAAATATTTATTGG + Intronic
924074159 1:240315960-240315982 TTCATGCATAACATATATATAGG + Intronic
924215659 1:241818988-241819010 TTGGTTTAGAATACATTTATTGG - Intergenic
924383834 1:243485510-243485532 TTCATTCAGAAGAGATTTCTTGG - Intronic
1063011062 10:2022015-2022037 TTTCTTCAGAACACATTTATGGG - Intergenic
1064921019 10:20518342-20518364 TCTCTTTAGAACATATTTATGGG + Intergenic
1065353547 10:24817102-24817124 TTTGTTTAAAAAATATTTATCGG - Intergenic
1066385157 10:34935614-34935636 TTCGTTCAACATATATTTATGGG + Intergenic
1066614737 10:37283249-37283271 TTGGTACATAACATCTTTATAGG - Intronic
1069444179 10:68457663-68457685 TTCATTTAGCAAATATTTATTGG - Intronic
1070002018 10:72385807-72385829 TTCTTACATAACATAGTTATGGG - Intronic
1070694761 10:78553787-78553809 TTTCTTCAGAATATATTTAAAGG + Intergenic
1071668353 10:87582806-87582828 TTTGTTCAGTAAATATTTATAGG - Intergenic
1072005618 10:91243955-91243977 TTCATTCAGCAAATATTTACTGG + Intronic
1072844587 10:98815705-98815727 TTCTTTCAGTAAATATTTACTGG - Intronic
1072868523 10:99090376-99090398 TTCGTTCAGAACATATTTATTGG - Intronic
1073785802 10:106888507-106888529 TTCATTCAAGAAATATTTATTGG - Intronic
1074475214 10:113767555-113767577 TGGGTTCAGAACATGTTTATTGG - Intronic
1075953029 10:126498375-126498397 TTCATTCAGCAAATATATATTGG - Intronic
1076034519 10:127188024-127188046 TTCGTTCAGTCAATATTTCTGGG - Intronic
1076668685 10:132107193-132107215 TTTGTTAAGAAGATAATTATTGG - Intronic
1078128299 11:8590361-8590383 TTCATTCAATAAATATTTATGGG - Intronic
1078654695 11:13227483-13227505 TTTACTCAGTACATATTTATTGG + Intergenic
1079942607 11:26700370-26700392 TCCATTCAGAAAGTATTTATTGG + Intronic
1080050795 11:27856932-27856954 TTCATTCAACAAATATTTATTGG - Intergenic
1080293304 11:30696054-30696076 TTCATTCAAAAAATATTTAAGGG - Intergenic
1080852428 11:36081380-36081402 TTTGTTCAGCACATTTTGATTGG + Intronic
1081034571 11:38126940-38126962 TTCATTCAATACATATTTATGGG + Intergenic
1082227069 11:49720575-49720597 TTCATTCAGAAAATATTTATTGG - Intergenic
1083453495 11:62762321-62762343 TTCATTCAGAAGATATATAGAGG - Intronic
1083775090 11:64890686-64890708 TTGGTTCAGCAAACATTTATTGG + Intergenic
1085100034 11:73792971-73792993 TTTGATCAGCAGATATTTATTGG + Intronic
1085502445 11:77036536-77036558 GTCTTTCAGCAAATATTTATCGG + Intronic
1086263526 11:84970377-84970399 TTCATTCAGTACATTTTTATTGG + Intronic
1086288655 11:85279080-85279102 TTCTTTCATAACATATCTTTTGG - Intronic
1086343731 11:85874148-85874170 TTCATTCAGTACATATTTAGTGG + Intronic
1086517436 11:87629079-87629101 TTCATTCAGTAAATATTTACTGG - Intergenic
1086598970 11:88608884-88608906 TTCATTCACCAAATATTTATTGG - Intronic
1086622357 11:88902511-88902533 TTCATTCAGAAAATATTTATTGG + Intronic
1086676980 11:89620392-89620414 TTCTTTCAGCATATATTTGTTGG + Intergenic
1088100314 11:106147081-106147103 TTTGTTCAGAATATACTTACTGG - Intergenic
1088100399 11:106148160-106148182 TTTGTTCAAAATATATTTATTGG + Intergenic
1088451974 11:109991699-109991721 TTCATTCAATAAATATTTATTGG + Intergenic
1089064842 11:115654730-115654752 TTTATTCAGAAAATATTTATTGG - Intergenic
1089754019 11:120673259-120673281 TTCATTCAGTAGATATTTAGTGG - Intronic
1089977515 11:122745351-122745373 TTCATTCAGCAAGTATTTATGGG + Intronic
1091149102 11:133310251-133310273 TATGTTCAGTACACATTTATGGG - Intronic
1092642457 12:10530013-10530035 TTAGTCCATAACATATTTATAGG + Intergenic
1093258193 12:16899210-16899232 TTCATTCAAAAAATGTTTATAGG - Intergenic
1093530607 12:20157826-20157848 TTCATTCAACAAATATTTATTGG - Intergenic
1094309556 12:29064400-29064422 TTCTTCCAGAACCTATTTTTAGG + Intergenic
1095158379 12:38886526-38886548 TTCTTTCAACACAGATTTATTGG + Intronic
1095405858 12:41866550-41866572 TTCGTTCAACAAATATTTAGTGG - Intergenic
1095408436 12:41894089-41894111 TTCATTCCAAATATATTTATTGG + Intergenic
1096243347 12:49971194-49971216 TTCATTCAACAAATATTTATTGG + Intronic
1096620743 12:52863351-52863373 TTCAGTCAGCGCATATTTATTGG + Intergenic
1097414248 12:59295048-59295070 TTTATCCAGAAAATATTTATTGG + Intergenic
1097813379 12:64043894-64043916 TTAATTCAAAATATATTTATTGG + Intronic
1099067115 12:77995428-77995450 CTCTTTCAAAACATTTTTATAGG - Intronic
1099414899 12:82373167-82373189 TTGGGGCATAACATATTTATAGG - Intronic
1100602934 12:96127867-96127889 TTCATTCAGAATATGTTTATTGG - Intergenic
1100609350 12:96178426-96178448 TACATTCAAAAAATATTTATCGG + Intergenic
1101181271 12:102220899-102220921 TTAGTTCAGAAAATAGTTCTAGG - Intergenic
1101438642 12:104685924-104685946 TTCGTGCAAAACATTTCTATAGG + Intronic
1101803152 12:108040169-108040191 CTCATTCAAAACATATTTATTGG + Intergenic
1102408334 12:112693941-112693963 TTCAATCAGCAAATATTTATTGG - Intronic
1103196609 12:119048974-119048996 TTCATTCAAGACATCTTTATTGG + Intronic
1103778761 12:123385158-123385180 TTCATTCAGTAAATATCTATTGG + Intronic
1104059811 12:125258079-125258101 TTTGTTCAGGAAATATTTACAGG + Intronic
1104702276 12:130916085-130916107 TTCATTCGATACATATTTATTGG + Intergenic
1105390283 13:19970662-19970684 TTCATTCAGTAAATATTTATTGG + Intronic
1105645113 13:22309628-22309650 TTTATTCAAGACATATTTATTGG + Intergenic
1107237493 13:38190043-38190065 TTCCTTCAGTACATTTTTTTGGG - Intergenic
1107687247 13:42915079-42915101 TTCATTCCGCAAATATTTATTGG - Intronic
1107725744 13:43297429-43297451 TTTTTTCAGAAAATATTGATTGG + Intronic
1107816265 13:44247262-44247284 TTGGTTCAATAAATATTTATTGG - Intergenic
1109580185 13:64320649-64320671 TTCATTTAGCAGATATTTATTGG - Intergenic
1110761725 13:79238058-79238080 TTCATTCAGCACAGATGTATTGG + Intergenic
1111802975 13:93003104-93003126 TTGTTTCAGAATATCTTTATTGG - Intergenic
1112104083 13:96221469-96221491 TTCACTCAAAAAATATTTATTGG - Intronic
1112908806 13:104456490-104456512 TTCATTCAGCAAACATTTATTGG + Intergenic
1113640309 13:111952585-111952607 TTGGCTCAGCATATATTTATGGG - Intergenic
1115029422 14:28776492-28776514 TTCATTCAGCACATTTTAATAGG - Intronic
1116884353 14:50205040-50205062 TTCTTTCAACAAATATTTATAGG - Intronic
1116957412 14:50938857-50938879 TTCATTAATAAAATATTTATAGG + Intronic
1117478958 14:56124413-56124435 TGCATTCAGCAAATATTTATTGG + Intronic
1118682702 14:68259864-68259886 TTCCTTCATTATATATTTATTGG + Intronic
1119013517 14:71022629-71022651 TACCTTCTGAACATTTTTATGGG + Intronic
1119348810 14:73947498-73947520 TTCATTCATAAAATATTTACTGG + Intronic
1119373919 14:74172967-74172989 TTCATTCAATACGTATTTATTGG - Intronic
1119499251 14:75109463-75109485 TTCATTCAAAAAACATTTATAGG + Intronic
1119515921 14:75248212-75248234 TTCATTCATTAAATATTTATAGG + Intronic
1120026866 14:79596438-79596460 TTGGTTCAGAACACATTTGAGGG - Intronic
1120563183 14:86021884-86021906 TTAATTCAGAAAATATTTATTGG - Intergenic
1120728340 14:87972078-87972100 TTTGTTCAGGAGATATTTCTTGG - Intronic
1120773239 14:88404822-88404844 TTTATTCAGCATATATTTATTGG + Intronic
1121781721 14:96626291-96626313 CTCATTCAGCAGATATTTATTGG + Intergenic
1122000685 14:98649448-98649470 TGTGGTCAGAACAAATTTATAGG - Intergenic
1124550511 15:30676633-30676655 TTCATTCAGCAGATATTTGTGGG - Intronic
1124576143 15:30910051-30910073 TCCATTCAGCAAATATTTATTGG - Intronic
1124841192 15:33243647-33243669 TTCATTCAATATATATTTATTGG + Intergenic
1125188366 15:36959470-36959492 TTAGTTCAACACGTATTTATTGG - Intronic
1125882410 15:43206158-43206180 TTCATTCAACACATATTTATTGG - Intronic
1126769153 15:52037839-52037861 TTCATTCAGTACATATTTTAGGG + Intronic
1126824768 15:52538103-52538125 TTTGTCCAGAAAGTATTTATTGG + Intergenic
1127288379 15:57549599-57549621 TTCATTTAGCACATATTTATTGG + Exonic
1127699356 15:61482799-61482821 TTCATTCAAAAAACATTTATTGG + Intergenic
1127749022 15:62014202-62014224 TTCATTCAGAAAATAATTACTGG + Intronic
1127788524 15:62377672-62377694 CTCATTCAGCATATATTTATTGG - Intergenic
1129820895 15:78601196-78601218 TTCATTCAACAAATATTTATGGG - Intronic
1131854337 15:96577278-96577300 TTCATTCAGAAAATATTTATTGG - Intergenic
1133593916 16:7272535-7272557 TTCATTCATCAAATATTTATAGG + Intronic
1134907627 16:17994425-17994447 TTCATTCAGCAAACATTTATTGG - Intergenic
1135701417 16:24635972-24635994 TTAATTCATTACATATTTATTGG + Intergenic
1137425287 16:48374274-48374296 TTCATCCAAAAAATATTTATTGG - Intronic
1138012111 16:53391201-53391223 TTTGTTCAGCAAACATTTATTGG + Intergenic
1139168343 16:64598401-64598423 TTCATTCAACACATATATATTGG + Intergenic
1139690253 16:68636739-68636761 TTCTTCCAGCAAATATTTATGGG + Intronic
1140301053 16:73757529-73757551 TTAATTCAGTAAATATTTATTGG + Intergenic
1140305787 16:73801327-73801349 TTCGTTCAGAAAATATGTATTGG - Intergenic
1140590027 16:76340622-76340644 TTCATTCAATACATATTTATAGG + Intronic
1140911106 16:79453763-79453785 TTCATTCAGCCCATATTTATTGG + Intergenic
1141116027 16:81310027-81310049 TTCCTTCAGCAAATATTTATTGG + Intergenic
1141887259 16:86901088-86901110 TTCCTTCAGTGCATATTTCTTGG + Intergenic
1141944411 16:87299414-87299436 TTCAATCAGCACATATTTATTGG - Intronic
1143068470 17:4268504-4268526 TTCATTCCAAATATATTTATCGG + Intergenic
1143161433 17:4874335-4874357 CTCATTCAGAAGATATTTAGTGG + Intronic
1143398645 17:6625291-6625313 GTCTTTCAGGACATATTTAGTGG - Intronic
1143629111 17:8127029-8127051 TTCGGTCAGCCCATATTTATGGG + Intergenic
1143630109 17:8134041-8134063 ATTCTTCAGCACATATTTATAGG + Intergenic
1143706430 17:8700817-8700839 TTCATTCAACAAATATTTATGGG - Intergenic
1144325905 17:14179540-14179562 TTCATTCAACACATATTTCTGGG - Intronic
1144474778 17:15576428-15576450 TTCATTCAACACATATTTCTGGG - Intronic
1144567484 17:16372058-16372080 TTCGTTCAATAAATATTTACTGG + Intergenic
1144587795 17:16498527-16498549 TTCATTCAGCAAGTATTTATGGG - Intergenic
1145855987 17:28157901-28157923 TTCATTCATCAAATATTTATAGG + Intronic
1147600069 17:41739918-41739940 TTCATTCAACAAATATTTATTGG - Intergenic
1147785347 17:42974470-42974492 TTCATTCAAAAGATATTTATTGG + Intronic
1148241397 17:46001711-46001733 TTCATTCAGACAACATTTATGGG + Intronic
1148249678 17:46065425-46065447 TTCTTTCAACAAATATTTATTGG - Intronic
1148994491 17:51697725-51697747 TTCATTCAGTGAATATTTATGGG - Intronic
1149146478 17:53499534-53499556 TTGGTTCAGTAGACATTTATTGG - Intergenic
1149402506 17:56312682-56312704 GTCGTTCATCACATATTTGTAGG + Intronic
1149903916 17:60507522-60507544 TTCATTTAGAAAATATTTAAGGG - Intronic
1149937981 17:60828768-60828790 TTCTTTCAAGACATGTTTATGGG + Intronic
1150600840 17:66649669-66649691 TGGGTTCAGCAAATATTTATGGG - Intronic
1151069607 17:71193714-71193736 TTCATTCAACAAATATTTATTGG + Intergenic
1151151327 17:72090056-72090078 TTCATTCAACAAATATTTATCGG - Intergenic
1151388234 17:73768438-73768460 TTCATTCAGTCCACATTTATTGG + Intergenic
1152495245 17:80666656-80666678 TTCATTCAGCAAATGTTTATTGG + Intronic
1153243887 18:3054919-3054941 TTTCTTCAAAAAATATTTATTGG - Intergenic
1154144240 18:11853523-11853545 TTGTTTCAGAAAATAATTATAGG + Exonic
1155224875 18:23720639-23720661 TTCATTAATAACACATTTATTGG - Intronic
1155530641 18:26762972-26762994 TTCTTTCAAAAAATATTTAATGG - Intergenic
1156325810 18:36074178-36074200 TTTGATCAGAATAAATTTATTGG + Intergenic
1157370844 18:47109933-47109955 TTCTTTAAAAAGATATTTATAGG - Intronic
1158110209 18:53932381-53932403 TTCTTTCTGAACATTTTTCTGGG + Intergenic
1158765161 18:60442088-60442110 ATCATTCAGGACATATTCATGGG - Intergenic
1159192719 18:65068813-65068835 TTCATTTAGAACAAATTAATTGG + Intergenic
1159233328 18:65637138-65637160 TTCGTTCAACAAATATTTATTGG + Intergenic
1161880110 19:6943689-6943711 TTCACTCAAAAAATATTTATTGG + Intergenic
1163986733 19:20960625-20960647 TTTGTTGAGAATATTTTTATAGG - Intergenic
1165789842 19:38484669-38484691 TTCATTCAACAAATATTTATGGG + Intronic
1166116868 19:40661667-40661689 TTCATTCAAAAAACATTTATTGG - Intergenic
1167039647 19:47015480-47015502 TTCATTCAACAAATATTTATCGG - Intergenic
1167210232 19:48129552-48129574 TTCGTTCAGCAAGTATTTACTGG - Intronic
1167474780 19:49693552-49693574 TTCATTCACCATATATTTATGGG + Intronic
926882106 2:17557331-17557353 TTCTTTCAACAAATATTTATTGG + Intronic
927092455 2:19722414-19722436 TTTGTTAAACACATATTTATGGG - Intergenic
927587817 2:24324534-24324556 TTCATTCAGTAAATGTTTATGGG + Intronic
927734625 2:25508244-25508266 GTCATTCAGCAAATATTTATTGG - Intronic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
928740454 2:34346219-34346241 TGCAATAAGAACATATTTATAGG - Intergenic
929315548 2:40473593-40473615 TTTGTTCAACAAATATTTATGGG - Intronic
929770473 2:44887646-44887668 TTCATTCAACACATATTTACTGG - Intergenic
930446035 2:51473611-51473633 TTCTTCAAGAAAATATTTATTGG - Intergenic
930589205 2:53307292-53307314 TTCCTTCAATAAATATTTATTGG + Intergenic
930690189 2:54354302-54354324 TTCCTTCAGAGCTGATTTATGGG + Intronic
931004545 2:57833059-57833081 TTTATTCAATACATATTTATAGG + Intergenic
933184422 2:79262864-79262886 TTTACTCAGAAAATATTTATGGG + Intronic
933534296 2:83553069-83553091 ACCATTCAGAACATAGTTATGGG - Intergenic
935186140 2:100734775-100734797 TTCATTTAGAAGATATTTACCGG - Intergenic
935396624 2:102616916-102616938 TTCGTCCAACACATATTTAGCGG + Intergenic
936466299 2:112754267-112754289 TTCATTCAAAACTTAGTTATTGG - Intronic
936507275 2:113117602-113117624 TTCATTCAAAACATATGTGTTGG - Intronic
937211193 2:120272611-120272633 TTTTTTAAGAACACATTTATTGG + Intronic
937602972 2:123761776-123761798 TTCGTTAAGAAGAAATTTGTCGG + Intergenic
940369825 2:152888887-152888909 TTCATCCAATACATATTTATTGG + Intergenic
940488254 2:154324214-154324236 TTTTTTTAGAACATATTTTTAGG + Intronic
940661706 2:156553311-156553333 TTCATTCAAAAAATATTTACTGG - Intronic
940845127 2:158632098-158632120 TTCATTTAGTACCTATTTATAGG + Intronic
941303971 2:163837856-163837878 TTCTTTAAAAAAATATTTATAGG - Intergenic
941583082 2:167324596-167324618 TTAGATTTGAACATATTTATGGG + Intergenic
942145140 2:173019346-173019368 TTCGTTCATCACATATTTACTGG + Intronic
942354581 2:175095640-175095662 TTCATTCAGAAAATCCTTATAGG + Intronic
942516497 2:176759038-176759060 TTTATGCAGTACATATTTATTGG + Intergenic
943254186 2:185572743-185572765 TTAGTTAAGAACATTATTATAGG + Intergenic
943567129 2:189529329-189529351 TTCATTCAACAAATATTTATTGG + Intergenic
943567657 2:189535538-189535560 TTCATTCAACATATATTTATTGG + Intergenic
943890039 2:193275392-193275414 TTCTTTTATTACATATTTATTGG + Intergenic
944245462 2:197525740-197525762 TTCAATCAGCAAATATTTATTGG + Intronic
944537178 2:200722697-200722719 TTATTTCAGAACAAATTTAAGGG + Intergenic
944928895 2:204495714-204495736 TTAATTCAGAACATCTTGATTGG + Intergenic
945145467 2:206733514-206733536 TTAGGTAAGAACATATTTCTTGG - Intergenic
946263471 2:218517403-218517425 TTCCTTTAGTACATATTTGTGGG + Intronic
946490445 2:220144308-220144330 CTCGTTCACCAAATATTTATTGG - Intergenic
946813622 2:223553154-223553176 CTCATTCAGCACATATTTATTGG + Intergenic
946881162 2:224178549-224178571 TTCTTTCAGCAAATATTTATTGG + Intergenic
947064388 2:226205395-226205417 TTTGTTCAGATCATATTTATTGG + Intergenic
947329079 2:229009394-229009416 TTCTTTCAGAACATATTTATGGG + Intronic
1168868319 20:1108041-1108063 TTCACTCATCACATATTTATTGG + Intergenic
1169732493 20:8801565-8801587 TGCATTCAAAAAATATTTATTGG - Intronic
1169949068 20:11022715-11022737 TTCATACAGAACATATTATTTGG - Intergenic
1170329234 20:15190474-15190496 TTCGTTTAGAAAATATGTATAGG + Intronic
1170906648 20:20521283-20521305 TGCCTTGAGAACATATTTCTTGG - Intronic
1172064358 20:32208391-32208413 TTGATTCAGCAAATATTTATGGG + Intronic
1172115261 20:32569881-32569903 TTTGTTCAGCACATTTTGATTGG - Intronic
1172214852 20:33227926-33227948 TTCTTTCATTCCATATTTATTGG + Intergenic
1173091568 20:39976961-39976983 CTTGTTCAGAAAATATTTGTTGG - Intergenic
1174531771 20:51220022-51220044 TTCGTTCAACATATATTCATGGG + Intergenic
1174952547 20:55058617-55058639 TTCATTCAGTACATATTTATTGG + Intergenic
1175268616 20:57717982-57718004 TTCATTCAGCAAATATTTATTGG - Intergenic
1175508629 20:59505805-59505827 TTTGTTCACAACATATTGAAAGG - Intergenic
1175691916 20:61071703-61071725 TTCTTTCAGTACACTTTTATTGG + Intergenic
1178661803 21:34512953-34512975 GTCTTACAGAAAATATTTATTGG + Intergenic
1178885500 21:36481840-36481862 TTCGTTCATCAAATAGTTATTGG + Intronic
1179142584 21:38739640-38739662 TTCATTCAGCAAATATTTACTGG + Intergenic
1181037903 22:20178718-20178740 TTCGCTCAGAACATTTTTATGGG + Intergenic
1181657466 22:24315413-24315435 TTTGCTCAGTAAATATTTATTGG + Intronic
1182404645 22:30115560-30115582 TTCATTCAGCAAATATTAATTGG + Intronic
1182954990 22:34415751-34415773 TTCATTCAAAAGGTATTTATTGG + Intergenic
1183237873 22:36633294-36633316 TTCATTCAACACATAGTTATTGG - Intronic
949142999 3:657995-658017 TTCATTCAAAAGACATTTATTGG + Intergenic
949446965 3:4145316-4145338 TTCATTCAGCAAATATTTACTGG - Intronic
949499935 3:4670152-4670174 ACTGTTCAGAACATGTTTATTGG + Intronic
949823215 3:8137756-8137778 CTCATTCAGTAGATATTTATGGG - Intergenic
949978034 3:9478393-9478415 TTCATTCAGCAACTATTTATTGG + Intronic
950328616 3:12137648-12137670 TGCTTTCAGCACATATTGATGGG - Intronic
951218169 3:20043229-20043251 TTCATTCAGTAAATATTTAGAGG + Intronic
951615550 3:24539253-24539275 ATCCTTCAGAAAATATTTGTTGG - Intergenic
954353619 3:50066453-50066475 TTTGATCAGAACTTCTTTATTGG - Exonic
956373402 3:68588371-68588393 TTCTTTCTAAAAATATTTATTGG + Intergenic
957602526 3:82356470-82356492 TTAGTTTAGCAAATATTTATTGG + Intergenic
958472755 3:94542133-94542155 TTCCTTTAGATAATATTTATAGG - Intergenic
959693794 3:109227669-109227691 TTCATTTAGCAGATATTTATTGG + Intergenic
960403081 3:117227695-117227717 TTCCTTCAATAAATATTTATTGG + Intergenic
960446231 3:117752159-117752181 TTCCTTGGGAACATACTTATTGG + Intergenic
960458507 3:117903274-117903296 TTCATTCAACAAATATTTATAGG - Intergenic
960654358 3:119986253-119986275 ATCATTCAGGACATAGTTATGGG + Intronic
963836680 3:150064955-150064977 TTCTTTCAGAGCTTATTTATTGG + Intergenic
963983723 3:151568383-151568405 TTCTTTCAGAATTTAATTATCGG + Intergenic
964045973 3:152327250-152327272 TTTACTCAGAAGATATTTATTGG + Intronic
964449081 3:156792777-156792799 TTCATTCAACAAATATTTATTGG + Intergenic
964511772 3:157460419-157460441 CTCATTCAAAAAATATTTATTGG + Intronic
965906151 3:173708979-173709001 TTCCTTCTTGACATATTTATAGG + Intronic
966265273 3:178033697-178033719 TTTATTCAGAACATATTCATTGG - Intergenic
966777761 3:183557819-183557841 TTCTTTCCGAATACATTTATAGG + Intergenic
969089634 4:4684216-4684238 TTCATTCAAAAAATATTTTTGGG + Intergenic
969492445 4:7507573-7507595 TTGGTTTAGAGCATATTTAGTGG - Intronic
969629112 4:8325174-8325196 TTCATTCAACAAATATTTATTGG - Intergenic
969987237 4:11225050-11225072 TTCATTCAGCAAATATTTAACGG - Intergenic
969993366 4:11287298-11287320 TTCATTCAGCAGAGATTTATTGG - Intergenic
970226192 4:13859629-13859651 TTCATTCAAAAAATATTTATTGG - Intergenic
971178174 4:24301894-24301916 TTCCTTCAGCAGACATTTATGGG - Intergenic
971348816 4:25838059-25838081 TTCATTCATCAAATATTTATGGG - Intronic
972207006 4:36785848-36785870 TTCATTCAGAAAATATTTAATGG + Intergenic
972209010 4:36814436-36814458 TTCATTCAGCAAATATTTATGGG - Intergenic
972311137 4:37884624-37884646 TTCACTCAGCACATATTCATTGG + Intergenic
972870392 4:43290982-43291004 TTTGTTTGGACCATATTTATTGG + Intergenic
972952576 4:44346295-44346317 CTCATTCAAAAGATATTTATTGG + Intronic
973622027 4:52736612-52736634 TTCGTTCAAAAAATATTAATTGG - Intronic
974380340 4:61131711-61131733 TTTGTTAAGACCATTTTTATGGG - Intergenic
974708569 4:65557444-65557466 TTGATTCAGCAAATATTTATAGG + Intronic
974805616 4:66876549-66876571 TTCATTCAGTAAATTTTTATGGG + Intergenic
975171162 4:71233227-71233249 TTCATTCAGTAAATATTTACTGG - Intronic
975788548 4:77921934-77921956 TTCGTTGAGCAAATAGTTATTGG + Intronic
976034948 4:80806471-80806493 TTCATTCAGCAAATATTTATTGG + Intronic
977828542 4:101562566-101562588 TTCATTCAGCAAACATTTATTGG - Intronic
978315437 4:107430666-107430688 TTCATTCAACAAATATTTATTGG - Intergenic
978640530 4:110866117-110866139 TTCCTTCAGCAAACATTTATTGG - Intergenic
979119375 4:116876260-116876282 TTCCTACAGAACTTATTAATAGG + Intergenic
979535033 4:121809958-121809980 TCATTTCAGAACATATTTATTGG + Exonic
980039081 4:127917755-127917777 GTCTTTCAGTACATATTTAAGGG - Intergenic
980146873 4:128996511-128996533 AGCATTCAGAACATAGTTATGGG - Intronic
980263626 4:130487170-130487192 TTCTTTCAAAAAATATTAATAGG - Intergenic
980471631 4:133260508-133260530 TTCCTACAGTATATATTTATTGG + Intergenic
981177292 4:141696596-141696618 TTCGTTCAGAAAAGGTTTATAGG + Intronic
981324739 4:143432803-143432825 TTCTCTCAGAACATAGTTAAGGG + Intronic
981585937 4:146302354-146302376 CTCTTTCAGCACATATTTATTGG + Intronic
981949884 4:150393269-150393291 TTCATTCAGCAAATATGTATTGG - Intronic
982098461 4:151945395-151945417 TTTTTTCTTAACATATTTATTGG - Intergenic
982613040 4:157601672-157601694 AGTTTTCAGAACATATTTATAGG + Intergenic
983605947 4:169584309-169584331 TACGTTAATAACACATTTATAGG + Intronic
983706440 4:170665923-170665945 TTAATTCAATACATATTTATTGG + Intergenic
984549589 4:181144738-181144760 TTATTTCAGAAAAGATTTATTGG + Intergenic
984570601 4:181388188-181388210 TTCATTCAACAAATATTTATTGG + Intergenic
986217843 5:5737649-5737671 TTATTTCAGAACATAATTGTAGG + Intergenic
986278342 5:6301696-6301718 TTCATTCAGCAAATATTTATTGG + Intergenic
986455129 5:7911112-7911134 TTGTTTCAGAACATATCTGTAGG + Intergenic
986568582 5:9141402-9141424 TTTGAACAGAATATATTTATGGG - Intronic
986683556 5:10255454-10255476 TTCATTCAACAAATATTTATTGG + Intronic
986714372 5:10512094-10512116 GTTGTTCAGCAAATATTTATTGG - Intronic
987290915 5:16507214-16507236 TATGTGCAGTACATATTTATGGG - Intronic
987764577 5:22208615-22208637 TTCACACAGAACATTTTTATTGG + Intronic
988194274 5:27981382-27981404 TACGTCCAAAACATATCTATAGG - Intergenic
988335786 5:29907455-29907477 ATCATTCAGTAAATATTTATTGG - Intergenic
988660311 5:33259325-33259347 TTCATTCAGCAAATATTTATTGG + Intergenic
988670933 5:33380876-33380898 TTCCTTCTATACATATTTATAGG - Intergenic
989011102 5:36874711-36874733 TTCATTCAGCAAGTATTTATTGG - Intergenic
989070645 5:37507240-37507262 TTCTTTTTGTACATATTTATGGG + Intronic
990025606 5:51183803-51183825 TTTATTCAGAAAATATTTATTGG + Intergenic
990687580 5:58323506-58323528 TTCCATCAGAAAATATTTAGAGG + Intergenic
990894875 5:60688055-60688077 TTCATTCAGCAAATATTTCTAGG + Intronic
991586394 5:68206453-68206475 TTAATTCAGAAAGTATTTATTGG + Intergenic
991590732 5:68248903-68248925 TTCCTTCAGAAAATATCTCTTGG - Intronic
991627812 5:68622471-68622493 TTCATTCAACAAATATTTATTGG - Intergenic
991899316 5:71441765-71441787 TTCACACAGAACATTTTTATTGG + Intergenic
991960867 5:72042756-72042778 TTCCTTCTAAAAATATTTATGGG - Intergenic
992010833 5:72525803-72525825 TTCTATCACAACATAATTATGGG - Intergenic
992265131 5:75011062-75011084 TTCATTCAGCAAATATTTACTGG + Intergenic
993147169 5:84110128-84110150 AACGTTCAGTGCATATTTATTGG - Intronic
997708001 5:135976832-135976854 CTCCTTCAGAACATTTTTCTAGG + Intergenic
999687484 5:154115990-154116012 CTCATTCAGTAAATATTTATGGG - Intronic
999690237 5:154140121-154140143 TTCATTCAACAAATATTTATTGG - Intronic
1001675756 5:173513696-173513718 GTCATTTAGAAAATATTTATTGG + Intergenic
1001971667 5:175960156-175960178 TTCGTTTTGAACGTATTGATTGG - Intronic
1002120814 5:177003015-177003037 TTCACTCAGCAAATATTTATAGG - Intronic
1002245775 5:177883621-177883643 TTCGTTTTGAACGTATTGATTGG + Intergenic
1002395467 5:178949544-178949566 TTCATTCTCAACATATTTGTTGG + Intronic
1003344052 6:5248899-5248921 TTCATTCAGCAAACATTTATTGG - Intronic
1003808344 6:9752050-9752072 TTTGCTCAGCAAATATTTATCGG - Intronic
1005123763 6:22421424-22421446 ATCATTCAGGAAATATTTATTGG + Intergenic
1005322080 6:24665574-24665596 TACATTCAGTAAATATTTATTGG + Intronic
1005664450 6:28037229-28037251 TTCTATCAGCAAATATTTATAGG - Intergenic
1006923249 6:37639945-37639967 TTCATTCAGAATTTAATTATTGG + Intronic
1009623524 6:66106163-66106185 TTCTTTCAGAACAGATCTATTGG + Intergenic
1010558357 6:77314543-77314565 TTGGTACAGAACATATTTTTGGG + Intergenic
1012218866 6:96623567-96623589 TTAATTCAGAAAGTATTTATTGG - Intergenic
1012425595 6:99110819-99110841 TCAGTTCAGAAAGTATTTATTGG - Intergenic
1012949597 6:105503785-105503807 TTCCTTTAGTAAATATTTATTGG - Intergenic
1012981900 6:105839923-105839945 TTCTTTCAACAAATATTTATTGG + Intergenic
1014506249 6:122261654-122261676 TTTGTTCAGTATATATTTATGGG - Intergenic
1014562018 6:122902285-122902307 TACATTCAATACATATTTATTGG - Intergenic
1015108802 6:129568625-129568647 TTCATTCAACAAATATTTATTGG - Intergenic
1015210731 6:130695472-130695494 TTCATTCAACAAATATTTATTGG - Intergenic
1015686862 6:135873885-135873907 TTCATTCAACAAATATTTATTGG + Intronic
1015787921 6:136936946-136936968 TTCTTTATGAACATTTTTATTGG - Intergenic
1016471946 6:144383854-144383876 TTCTTTCAGAATATAATTACAGG - Intronic
1016861344 6:148721700-148721722 TTCATTCACCAAATATTTATTGG + Intergenic
1017048157 6:150366279-150366301 TTCATTCAAAATATATTTTTTGG - Intergenic
1017176665 6:151511480-151511502 TTCATTCACCAGATATTTATGGG + Intronic
1017537862 6:155367655-155367677 TTCATTCAGCGAATATTTATTGG + Intergenic
1018013101 6:159689657-159689679 TACGTTAAGAACATATGTCTGGG + Intronic
1019957780 7:4429626-4429648 TTTATTTAGAACATACTTATAGG - Intergenic
1020392515 7:7673832-7673854 TTCATTCAGCAAATATTTATTGG - Intronic
1020572120 7:9876960-9876982 TTCATTCAGCATATATTTATTGG - Intergenic
1020674655 7:11167490-11167512 ATAGTTCAGAAAATATTGATTGG + Intronic
1021065535 7:16167807-16167829 TTCGTTAAGAATAGATTGATAGG - Intronic
1021640677 7:22733457-22733479 TTTGTTCAAAAAATATTTACTGG - Intergenic
1021797550 7:24272291-24272313 TTTGATCAATACATATTTATTGG + Intergenic
1022593186 7:31686140-31686162 TTCTGTGAGAACATATTTCTTGG + Intergenic
1022628601 7:32063984-32064006 ATCGTTCAGCATATTTTTATTGG - Intronic
1022636051 7:32136554-32136576 TTCTTTCAGCAAATATTTATTGG - Intronic
1023003422 7:35837337-35837359 TTCTTTCATAACCTATCTATTGG + Intronic
1023151242 7:37203305-37203327 TTCGGGCATAACATCTTTATAGG - Intronic
1024657432 7:51463443-51463465 TTCATTTAGGAAATATTTATTGG - Intergenic
1024784398 7:52890265-52890287 TTCTATCTGAATATATTTATAGG + Intergenic
1025039416 7:55627487-55627509 TTCCTACAGTATATATTTATTGG + Intergenic
1025620708 7:63167650-63167672 TTCGTTCAGAAAATGTGTTTGGG - Intergenic
1025829198 7:65035169-65035191 TTCATTCAAAATATATATATGGG + Intergenic
1025916413 7:65870125-65870147 TTCATTCAAAATATATATATGGG + Intergenic
1028070627 7:86445764-86445786 TACTTTCACTACATATTTATTGG - Intergenic
1028241012 7:88420595-88420617 TTCAGTCAGATCCTATTTATAGG + Intergenic
1030142282 7:106317551-106317573 TGTCTTCAGAACATTTTTATGGG - Intergenic
1030581368 7:111359793-111359815 TTCATTCAATAAATATTTATTGG - Intronic
1030655062 7:112158340-112158362 TTTGTTCAAAAAGTATTTATTGG - Intronic
1031373301 7:120994350-120994372 TTCATTTAGTAAATATTTATTGG + Intronic
1031716159 7:125111059-125111081 TTTGTTAAGAACATCTTTGTAGG + Intergenic
1031943770 7:127816976-127816998 TTCATTCAGCAGATATTTTTTGG + Intronic
1033949493 7:146766176-146766198 TTCATTCAATAAATATTTATTGG - Intronic
1034068258 7:148157337-148157359 TTTGCTCAGCAAATATTTATTGG - Intronic
1035594236 8:842229-842251 TTTCTTCAAAACATATTCATGGG + Intergenic
1035814197 8:2521485-2521507 TTCATTCAGAAAACGTTTATTGG - Intergenic
1037186210 8:16066586-16066608 TTTATTCAACACATATTTATTGG + Intergenic
1037423415 8:18728019-18728041 TTCATTCAGCAAATATTTAAGGG - Intronic
1038022566 8:23562488-23562510 TTCATTCAACAAATATTTATTGG + Intronic
1038292360 8:26261286-26261308 TTAGTTCAGAAGATTTTAATAGG - Intergenic
1038650026 8:29394184-29394206 TTCATTCAGCAAATATTTACTGG - Intergenic
1039073866 8:33671140-33671162 TTCCTTCAGGAAATATCTATCGG + Intergenic
1039623577 8:39024647-39024669 TTCATTTAAAATATATTTATTGG + Intronic
1040521866 8:48183967-48183989 TTCATTCAGGACATAGTCATGGG + Intergenic
1040522528 8:48190699-48190721 TTCATTCAGCCAATATTTATTGG + Intergenic
1042569141 8:70143570-70143592 TTCCTTCAGCAAATATTTATTGG - Intronic
1042640180 8:70925304-70925326 TTTATTCAACACATATTTATAGG - Intergenic
1042721359 8:71830233-71830255 TTAGTTCAGCACATATAAATTGG + Intronic
1043487673 8:80714301-80714323 TTCGTTCAACAAATATTTGTTGG - Intronic
1043714824 8:83468361-83468383 TTCCTTCAGAATTTATATATAGG + Intergenic
1043962174 8:86429525-86429547 TTTCTTCAGAATATATTTCTAGG + Intronic
1044261717 8:90132440-90132462 TTCATTCAACAGATATTTATTGG + Intergenic
1045336722 8:101211209-101211231 TTCATTCAACAAATATTTATTGG - Intergenic
1045710280 8:104975244-104975266 TTTCTTCAGAAAATGTTTATTGG + Intronic
1045815842 8:106274910-106274932 CTGGTTCAAACCATATTTATTGG - Intronic
1046303193 8:112325588-112325610 GTCATTCAGCAAATATTTATTGG - Intronic
1046433578 8:114159420-114159442 CTCTTTGAGAAAATATTTATGGG + Intergenic
1046970679 8:120219765-120219787 TTTGTTGAGAACATATGTTTGGG + Intronic
1047559862 8:125975099-125975121 TTCATTCAACAAATATTTATAGG - Intergenic
1048352319 8:133626030-133626052 TTTGTTCAACAAATATTTATTGG - Intergenic
1048549355 8:135419932-135419954 TTCATTCATAACATATTAAGGGG - Intergenic
1051135895 9:13919960-13919982 TTCGGTCAGTAAATATATATTGG - Intergenic
1052261223 9:26518711-26518733 TTCCTTCAGTACACATTTGTTGG - Intergenic
1052334732 9:27307759-27307781 TTGGTTCAGCACAGATTTGTAGG - Intergenic
1052740403 9:32386787-32386809 TTCTTTCAGTAGATTTTTATTGG + Intronic
1053380676 9:37647603-37647625 TTCATTCAATAAATATTTATGGG + Intronic
1053524075 9:38811002-38811024 TACGTAGAGAAAATATTTATTGG - Intergenic
1054196307 9:62035411-62035433 TACGTAGAGAAAATATTTATTGG - Intergenic
1054642098 9:67553276-67553298 TACGTAGAGAAAATATTTATTGG + Intergenic
1054993532 9:71357838-71357860 TTCCTTCATAACAGATTCATAGG - Intronic
1055166279 9:73199284-73199306 TTAATTCAGAATATATTTTTTGG - Intergenic
1055418622 9:76111531-76111553 TACCCTCAGAACATTTTTATTGG + Intronic
1056487234 9:87071680-87071702 TTCATTCAACAAATATTTATTGG + Intergenic
1056890626 9:90488530-90488552 TTCCTTCAGCAGATATTGATTGG + Intergenic
1057066330 9:92055591-92055613 TTCATTCAGAATATTTTTTTAGG - Intronic
1057779182 9:98035877-98035899 CTCATTCAGAAAATATTTATTGG + Intergenic
1057919361 9:99084008-99084030 TTTATTCAGCACATATTTGTGGG - Intergenic
1058066844 9:100558049-100558071 TTCATTCAGTATATGTTTATTGG + Intronic
1058111246 9:101032603-101032625 TTCATTCAACAAATATTTATTGG - Intronic
1058934585 9:109756845-109756867 TTTGATGAGTACATATTTATAGG + Intronic
1059082005 9:111260054-111260076 TTCATTCGGAAAACATTTATTGG - Intergenic
1059598167 9:115745661-115745683 TTGGTACAGAACCTTTTTATAGG + Intergenic
1060185150 9:121559669-121559691 TTTATTCAGTACATGTTTATTGG + Intergenic
1061649764 9:132038136-132038158 TTCATTCAGCAAATATTTATGGG + Intronic
1185956302 X:4494737-4494759 GTCATTCAGAACATGTTTATGGG - Intergenic
1186537579 X:10365695-10365717 TTAGTTCAGCAAACATTTATTGG + Intergenic
1186669524 X:11755899-11755921 TTCATTCAGCAAATATTTATTGG - Intergenic
1187405127 X:18996834-18996856 TTCACTCAGCAAATATTTATTGG - Intronic
1187714873 X:22092671-22092693 TCAATTCAAAACATATTTATTGG - Intronic
1188344201 X:29044129-29044151 ATCATTTAAAACATATTTATGGG + Intronic
1188598481 X:31930773-31930795 TTCATTCGAAACATATTTAGTGG - Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189307186 X:39995642-39995664 TTCATTCAGTAAATATTTTTGGG - Intergenic
1189634912 X:42996854-42996876 TTCATTCAATACTTATTTATTGG - Intergenic
1190190455 X:48272649-48272671 TTCCTTCAGAAAATTTGTATTGG - Intronic
1191742484 X:64450547-64450569 TTCTTTCAACAAATATTTATTGG - Intergenic
1192022633 X:67409941-67409963 TCCGTGAAGAACATCTTTATGGG - Intergenic
1192301302 X:69905922-69905944 TTCAGTCAGTAAATATTTATTGG - Intronic
1192372374 X:70525269-70525291 TTCTTTCAACAAATATTTATTGG + Intergenic
1193868758 X:86770335-86770357 TTAGTTCAGAACATATTTTGAGG + Intronic
1194207257 X:91026676-91026698 TTGATTTACAACATATTTATAGG + Intergenic
1194622621 X:96191853-96191875 TTCATTCAACAAATATTTATTGG + Intergenic
1194685830 X:96913465-96913487 TTGCTTCACAAAATATTTATTGG + Intronic
1195427505 X:104751225-104751247 TTTGTTCAGCAAATATTTATTGG + Intronic
1195472421 X:105245985-105246007 TTCATTCAGCACATATGTATTGG + Intronic
1195546764 X:106121275-106121297 CTAATTCAGAACATATTTAAAGG - Intergenic
1196039810 X:111190002-111190024 TTCATTCAACAAATATTTATTGG + Intronic
1196135109 X:112200454-112200476 TTCATTCAACAAATATTTATTGG - Intergenic
1196776988 X:119347458-119347480 TTCATTCAGCAGATATTTATTGG + Intergenic
1196818997 X:119688076-119688098 TTCCTTCAGCACATATTCACTGG - Intronic
1197000486 X:121432881-121432903 TTTATTCAAAACATATTTACTGG + Intergenic
1197029191 X:121793432-121793454 TTCTTTCAGAATTTCTTTATAGG + Intergenic
1197173093 X:123456152-123456174 TTCATTCAATATATATTTATGGG + Intronic
1197454607 X:126663184-126663206 TTTATTCAGAAAATATTAATTGG - Intergenic
1198385831 X:136128627-136128649 TTTATTCAACACATATTTATTGG - Intergenic
1198427567 X:136535363-136535385 TTTGTTCAGAATATATCTGTTGG + Intronic
1198666729 X:139032364-139032386 TTCCTTCAGAATATACCTATAGG + Intronic
1198740589 X:139838081-139838103 TTCCTTCTGAACATATGTATTGG - Intronic
1198903722 X:141538241-141538263 ATCATTCAGAACATAGGTATGGG - Intergenic
1199399552 X:147381268-147381290 TTCGTTCAACAAATATTCATTGG + Intergenic
1200552999 Y:4601415-4601437 TTAATTTACAACATATTTATAGG + Intergenic
1201744689 Y:17358988-17359010 GTCATTCAGGACATGTTTATGGG - Intergenic