ID: 1072872215 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:99132588-99132610 |
| Sequence | GAGAGCAAGACGAAGGAGGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072872205_1072872215 | 24 | Left | 1072872205 | 10:99132541-99132563 | CCTGGTTCATCGCATTGGGTCTG | 0: 1 1: 6 2: 399 3: 948 4: 1378 |
||
| Right | 1072872215 | 10:99132588-99132610 | GAGAGCAAGACGAAGGAGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072872215 | Original CRISPR | GAGAGCAAGACGAAGGAGGG TGG | Intronic | ||
| No off target data available for this crispr | |||||