ID: 1072872215

View in Genome Browser
Species Human (GRCh38)
Location 10:99132588-99132610
Sequence GAGAGCAAGACGAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072872205_1072872215 24 Left 1072872205 10:99132541-99132563 CCTGGTTCATCGCATTGGGTCTG 0: 1
1: 6
2: 399
3: 948
4: 1378
Right 1072872215 10:99132588-99132610 GAGAGCAAGACGAAGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072872215 Original CRISPR GAGAGCAAGACGAAGGAGGG TGG Intronic
No off target data available for this crispr