ID: 1072874952

View in Genome Browser
Species Human (GRCh38)
Location 10:99162733-99162755
Sequence CTTGGTAAACTGAAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072874952_1072874957 -9 Left 1072874952 10:99162733-99162755 CCCTGCCCCTTCAGTTTACCAAG 0: 1
1: 0
2: 1
3: 17
4: 152
Right 1072874957 10:99162747-99162769 TTTACCAAGTTTATCCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072874952 Original CRISPR CTTGGTAAACTGAAGGGGCA GGG (reversed) Intronic
901689195 1:10961394-10961416 CTTCTTAACCTGAAGGAGCAGGG - Intronic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
904923347 1:34026294-34026316 CTTGGTAACCATAAGGGGAAAGG - Intronic
905319949 1:37108780-37108802 CTTGGGAAACTGAATGACCAAGG + Intergenic
909259961 1:73474776-73474798 CTTGGGAAACAGAGTGGGCAAGG + Intergenic
910834990 1:91500088-91500110 CTTGGTATGTTGCAGGGGCAGGG - Intergenic
912225544 1:107729547-107729569 CATGGTGCACTGAAGGGGCATGG + Intronic
913329319 1:117654131-117654153 CTTGTTGAATTGAAGGGGGAGGG + Intergenic
919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG + Intergenic
919706694 1:200683061-200683083 CATGGTCATCTGAGGGGGCATGG + Intergenic
920120634 1:203654272-203654294 TTTGGTAAACTGGCCGGGCACGG - Intronic
924310821 1:242741593-242741615 ATTAATAGACTGAAGGGGCACGG - Intergenic
1063203837 10:3811756-3811778 CTTGCTAACCTGCAGGGGCTGGG + Intergenic
1064443370 10:15372104-15372126 CTTGGTAAACTGACTTAGCAGGG + Intergenic
1065343135 10:24724171-24724193 CTTGGGAGACTGCAGGGGCGGGG - Intergenic
1066143813 10:32535610-32535632 CTAGGTAAAGAGAAGGGGCTTGG + Intronic
1066350271 10:34630920-34630942 CTTGGGAAGCTGAAGTGGCAGGG - Intronic
1066612538 10:37265296-37265318 CTTGGTAAATTGAGGAGGCATGG - Intronic
1067479292 10:46584867-46584889 CTCGGGAAACAGGAGGGGCAGGG - Intronic
1067615447 10:47756934-47756956 CTCGGGAAACAGGAGGGGCAGGG + Intergenic
1068426533 10:56872645-56872667 CTTGGTTAACTGCAGGTGCTTGG - Intergenic
1072362187 10:94670485-94670507 CTTGGTACACTGTAGAGGAAGGG - Intergenic
1072520774 10:96228037-96228059 ATTGGTAAGCTGCAGGGTCAAGG + Intronic
1072874952 10:99162733-99162755 CTTGGTAAACTGAAGGGGCAGGG - Intronic
1073747810 10:106490114-106490136 CTTGGGAAGCTGAGGTGGCAGGG - Intergenic
1075033826 10:119045677-119045699 CTTGGGAAACTGAGGTGGGAGGG - Intronic
1075330359 10:121569771-121569793 CTTGGTAAACTGAGAAAGCAAGG + Intronic
1075694621 10:124424579-124424601 CTTGGTAAGCTGAATGGGCCTGG - Intergenic
1076112490 10:127871890-127871912 CCTGGTAAACACAAGGGACAGGG - Intergenic
1076369780 10:129944979-129945001 CTTGGTAAACTGATTTTGCAAGG + Intronic
1076484495 10:130807379-130807401 CTTAGCAAAGTGAAGGGGCCAGG + Intergenic
1078079023 11:8190716-8190738 ATTGGTAACCTAATGGGGCACGG - Intergenic
1078200105 11:9173595-9173617 TTTGGTAAGCTGAAGGGGGAGGG - Intronic
1083659217 11:64244587-64244609 AGTGGAAAACTGAGGGGGCAGGG + Exonic
1084917196 11:72437696-72437718 CTAAGTAAACTGAAGGGCCCTGG - Intergenic
1086796784 11:91115047-91115069 TTTGCTCAACTGAAGGGGAATGG - Intergenic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1090667759 11:128926111-128926133 CTTGGGACACAGAAGGGGCTTGG - Intergenic
1091804400 12:3345661-3345683 CTTATTTAACTGAAGGGGCACGG - Intergenic
1091937855 12:4447504-4447526 GCTGGTAAACTGAATGGGGAGGG + Intergenic
1094754728 12:33454780-33454802 CTTGGTATACAGAACGGCCAAGG - Intergenic
1095873441 12:47055306-47055328 GTTTGTAAAGTGAAGTGGCATGG - Intergenic
1097063420 12:56302447-56302469 CTTGGGAACTTGAAGGGGCAAGG + Intronic
1101208466 12:102512766-102512788 CCTTCTAAACAGAAGGGGCAAGG + Intergenic
1101586327 12:106088923-106088945 CCTGATAAAATGAAGGGGGAAGG + Intronic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1103734732 12:123052986-123053008 CTTGGGAGGCTGAAGGGGGAGGG - Intronic
1103794503 12:123494089-123494111 CTTGGTGAAGTCAAGAGGCAGGG - Intronic
1108179576 13:47827468-47827490 CTTGGTAAAGTGATGGGAAATGG + Intergenic
1115557449 14:34554652-34554674 CTGGGTAAATACAAGGGGCAGGG + Intergenic
1116189798 14:41649586-41649608 CTTGCTAAACTGACGCAGCAGGG - Intronic
1117558549 14:56911412-56911434 CTTGGTGGAATGATGGGGCATGG + Intergenic
1121804801 14:96808364-96808386 CTTGGTAACCCAAAGAGGCAAGG - Intronic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1122579891 14:102764876-102764898 CTTGTTAAACTGATGAAGCAGGG + Intergenic
1124609485 15:31198489-31198511 CATGGTGAGCTGAAGGGACAAGG - Intergenic
1127134861 15:55909626-55909648 CTTTGTAGGCTGAAGGGGCTTGG - Intronic
1128371368 15:67041956-67041978 CTTTCTAAAGAGAAGGGGCAAGG + Intergenic
1128741576 15:70087618-70087640 CTTGGTAAAGGGTAGGAGCATGG - Intronic
1133184892 16:4088975-4088997 CTGGGGAAACTGAAGGGAAATGG - Intronic
1133426507 16:5695022-5695044 CTTGGTAATCTCAAGTCGCATGG - Intergenic
1135071202 16:19353342-19353364 CTTGGGAAACTGAGGTGGGAGGG - Intergenic
1135496532 16:22956525-22956547 GTAGGTAAACTAAAGGGCCAGGG + Intergenic
1135666251 16:24337902-24337924 CATGGGCAACTGAAGGGACATGG + Intronic
1139745580 16:69071879-69071901 CTTGGCAAACTGAAAAGGGAAGG - Intronic
1143203828 17:5129854-5129876 CTGGTTAGACTGAAGGGCCATGG + Intronic
1144875008 17:18392966-18392988 CTGGTTAGACTGAAGGGCCATGG + Intergenic
1145157216 17:20551455-20551477 CTGGTTAGACTGAAGGGCCATGG - Intergenic
1147548065 17:41418634-41418656 ATTGGTGAACTGAAGAGGGACGG + Intergenic
1147768188 17:42850837-42850859 TTTGGAAAGCTAAAGGGGCAGGG + Intergenic
1148216996 17:45838765-45838787 CTCAGTGAACTGAAGGGGCTTGG + Intergenic
1149517148 17:57289220-57289242 TTTGGTTAAGTGAAAGGGCAGGG + Intronic
1151544830 17:74786376-74786398 CTTGGTGCACAGATGGGGCAGGG - Intronic
1156905070 18:42342596-42342618 CTTTGGAAACTGAATGGGAATGG - Intergenic
1160359348 18:78258183-78258205 CATGGTAAACTGATGCAGCATGG + Intergenic
1161676518 19:5653434-5653456 CTGGCTAAATTAAAGGGGCAGGG + Intronic
1161763642 19:6193359-6193381 CTTGGTTAACTCAAGAGTCAAGG + Intronic
1163140473 19:15344621-15344643 CTTTGTCAACTGGATGGGCACGG - Intergenic
1164655029 19:29914639-29914661 ACTGGAAAGCTGAAGGGGCAGGG + Intergenic
926132072 2:10309670-10309692 CCTGGTAAATAGAAGGGGCTGGG + Intronic
928107201 2:28478172-28478194 TTTGGGAGACTGAAGGGGCATGG - Intronic
928268143 2:29830022-29830044 CTTGGCAAACTGAAGTGGCATGG + Intronic
930307043 2:49687543-49687565 ATTGGTAGACTGAAGAGTCAGGG - Intergenic
931319579 2:61163139-61163161 CTTAGAAAACAGAAGGGACATGG + Exonic
932257134 2:70297582-70297604 CTTGGTCAATTAAAGGGACATGG + Intronic
935208790 2:100920786-100920808 CTTGGCCAAGCGAAGGGGCAGGG + Intronic
938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG + Intronic
938945539 2:136208805-136208827 CTTTGTAAAGTGAAGGGACTTGG + Intergenic
945645458 2:212486237-212486259 CTTGGTAAAATGAGGGGAGAAGG + Intronic
946254941 2:218435448-218435470 CTTGGTAACCTGGAGGCGGAGGG - Intronic
946937837 2:224739682-224739704 CTTGGTAAACTGAAGCAAGAGGG - Intergenic
947313970 2:228834965-228834987 CTTGGTGCACTCAAGGGACAGGG - Intergenic
948197015 2:236103918-236103940 CTTGGTAAACGCACAGGGCAGGG - Intronic
1172953662 20:38739501-38739523 ACTGGGAAACTGAAGGGGCGGGG - Intergenic
1173131695 20:40399985-40400007 ATTCTTCAACTGAAGGGGCAAGG - Intergenic
1173182682 20:40816519-40816541 CCTGCCAGACTGAAGGGGCAAGG - Intergenic
1174167205 20:48593446-48593468 TTTGGTCATCTGAAGGGGGATGG + Intergenic
1174519451 20:51118478-51118500 TTTGCTAAGCTGAAGGGACAGGG - Intergenic
1175016614 20:55798121-55798143 CTTGGTACAGTAAAGGTGCAAGG + Intergenic
1177231813 21:18331234-18331256 CTTGATCATCTGAAGGAGCAAGG + Intronic
1177403464 21:20636367-20636389 CTTGGTAAACTGACTTAGCAGGG + Intergenic
1181359815 22:22325629-22325651 CTTTGTGTCCTGAAGGGGCAGGG - Intergenic
1181369880 22:22407362-22407384 CTTTGTGTCCTGAAGGGGCAGGG - Intergenic
1182576657 22:31277285-31277307 AGTGGAAAACTGAGGGGGCAGGG - Exonic
1184331323 22:43829687-43829709 CGTGGTAAAATAATGGGGCAGGG - Intronic
949414556 3:3800439-3800461 CTTGGTAAGAGAAAGGGGCAAGG + Intronic
949431868 3:3985442-3985464 ATCGATAAACTGAAGGAGCATGG - Intronic
949588317 3:5465729-5465751 CTTTGTAAACTGGAGGTGAAGGG + Intergenic
949650451 3:6152660-6152682 CTTAGTAAATTGATGGGGCCTGG - Intergenic
951357364 3:21684191-21684213 CTTTATAAACTAAAGGGGCCAGG - Intronic
958950527 3:100411016-100411038 CTCCTTAAGCTGAAGGGGCAAGG + Intronic
959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG + Intronic
961995294 3:131235582-131235604 CCTGGTAATCTGAAGGCACAGGG + Intronic
963515069 3:146299281-146299303 CCTGGTAAACAGAAAGGACAAGG + Intergenic
963954217 3:151235272-151235294 CTTTGTAAACTGATGGGGGCAGG + Intronic
964436892 3:156663087-156663109 CGAGGTAAACTGAAGAGCCAGGG - Intergenic
964767735 3:160195087-160195109 CCTGGGAAACTGAAGGTTCAAGG - Intergenic
965506516 3:169521275-169521297 CTTGGTAAGCTCAAAGTGCAGGG - Intronic
969154473 4:5198354-5198376 ATTTGTAATCTGATGGGGCATGG + Intronic
973053005 4:45617860-45617882 CTTGGGAAACTGAGGTGGGAGGG - Intergenic
974982682 4:68979525-68979547 CTTGCTAAAGTGCAAGGGCAGGG + Intergenic
979999246 4:127469446-127469468 CTTGGTAAAAAGAAGAGGGAGGG - Intergenic
980653802 4:135756093-135756115 CTTGGTAAACTGATTTAGCAAGG + Intergenic
980923764 4:139114763-139114785 AGTGGAAAACTGAGGGGGCAGGG + Intronic
982636271 4:157900691-157900713 CTTTGGAATCTTAAGGGGCAAGG - Intergenic
985365039 4:189221170-189221192 TTTGGTAAACTGAGGGGGCTGGG - Intergenic
986731130 5:10635854-10635876 TTTGCTGAACTGAAGGGGCTAGG + Intronic
988728893 5:33950565-33950587 CTAGGTAAAGGGAAGGGGAAGGG + Intronic
989191042 5:38669986-38670008 CTTTGTAAAATAAAGAGGCAGGG + Intergenic
989410428 5:41113669-41113691 CATGGTCAACTGTAGTGGCAGGG + Intergenic
990767024 5:59195343-59195365 CCTGGTGCACTGAAGTGGCAAGG + Intronic
991329847 5:65482187-65482209 CTTGGAAAAATGAAGGGGGAGGG + Intergenic
992691321 5:79243158-79243180 GTTATTTAACTGAAGGGGCAAGG + Intronic
994009310 5:94881646-94881668 TTTGGAAAACTGAAGAGGCATGG - Intronic
1001092366 5:168750943-168750965 CTTTGTAATATTAAGGGGCAGGG + Intronic
1005762274 6:28978155-28978177 CTTGCTAAACTGACTTGGCAGGG - Intergenic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1008031273 6:46697515-46697537 TTTGGGAAACTGAAGTAGCATGG + Intronic
1010863186 6:80938539-80938561 CTTGGATAACTGAGGGGACAAGG + Intergenic
1016804292 6:148197457-148197479 CTTGGTTAACTCAAGGGACAGGG - Intergenic
1016807394 6:148225556-148225578 CTTTGGAGACTGAAGGGGAAAGG + Intergenic
1019663162 7:2237112-2237134 CTTGGGAAGCTGAGGTGGCAGGG - Intronic
1022175086 7:27864782-27864804 CTTGGTTAACGGATGGGGAAAGG - Intronic
1024208243 7:47182030-47182052 CTTGGGAAGCTGCTGGGGCATGG - Intergenic
1024611140 7:51065441-51065463 CTCCATAAACTGTAGGGGCAAGG + Intronic
1024665977 7:51547727-51547749 CTTGGTAAAGAGAAAGGGTAAGG - Intergenic
1026122341 7:67548922-67548944 CTTGGGAGACTGAAGTGGGAGGG - Intergenic
1027203192 7:76075590-76075612 CTTGGGAAGCTGAAGTGGGAGGG + Intergenic
1027415141 7:77966508-77966530 TTTGCTAAAGTGATGGGGCATGG - Intergenic
1027773512 7:82435974-82435996 CATTGCATACTGAAGGGGCATGG - Intronic
1031482301 7:122293018-122293040 CCTGGTAAACTAAAGGAGTATGG - Intergenic
1032824657 7:135557427-135557449 TTTGGTAAACTGAAATGTCACGG + Intergenic
1041631305 8:60090660-60090682 CTTAGAAAAATGAAGGGGAAAGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044091708 8:88010608-88010630 CTTGGCAAGCTGATTGGGCAGGG - Intergenic
1044215194 8:89601143-89601165 CTTGGAAAACTGGCCGGGCACGG + Intergenic
1044269783 8:90228367-90228389 CTGGGTAAACTCAAGAGCCATGG + Intergenic
1044596284 8:93961859-93961881 CTTGGTAAAATAAAAAGGCATGG + Intergenic
1047054313 8:121147175-121147197 TTAGGTAAACTGAAGGAGGAAGG - Intergenic
1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG + Intergenic
1049982034 9:912976-912998 ATTTGTAAAATGAATGGGCATGG - Intronic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1059378212 9:113902221-113902243 CTTTGTAAATTGCAGGGTCAGGG + Intronic
1059476427 9:114551500-114551522 CTTGGGAGGCTGAAGGGGGAGGG - Intergenic
1061979774 9:134095268-134095290 CTTGGGAGACTGAGGGGGCCAGG + Intergenic
1186150170 X:6666220-6666242 CTTGGTTAAATGAAGGGCCAGGG + Intergenic
1186563026 X:10632910-10632932 AATGGTAGACTGAATGGGCATGG - Intronic
1189795759 X:44644793-44644815 CTTGGCAAAGTGTGGGGGCAAGG - Intergenic
1197322048 X:125044480-125044502 CTTGGGAAGCTGAAGTGGTAAGG + Intergenic
1197873076 X:131078475-131078497 CATGGTATACTGAAGGGGTAAGG + Intronic
1198078987 X:133220846-133220868 CTCTGATAACTGAAGGGGCAGGG - Intergenic