ID: 1072881867

View in Genome Browser
Species Human (GRCh38)
Location 10:99236112-99236134
Sequence ATCTCTTAAAGGGGCGGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072881867_1072881875 17 Left 1072881867 10:99236112-99236134 CCGGCACCGCCCCTTTAAGAGAT No data
Right 1072881875 10:99236152-99236174 TTTAACTTTTTAAAGGTAAGGGG No data
1072881867_1072881876 20 Left 1072881867 10:99236112-99236134 CCGGCACCGCCCCTTTAAGAGAT No data
Right 1072881876 10:99236155-99236177 AACTTTTTAAAGGTAAGGGGAGG No data
1072881867_1072881874 16 Left 1072881867 10:99236112-99236134 CCGGCACCGCCCCTTTAAGAGAT No data
Right 1072881874 10:99236151-99236173 TTTTAACTTTTTAAAGGTAAGGG No data
1072881867_1072881879 28 Left 1072881867 10:99236112-99236134 CCGGCACCGCCCCTTTAAGAGAT No data
Right 1072881879 10:99236163-99236185 AAAGGTAAGGGGAGGGGAGCAGG No data
1072881867_1072881878 22 Left 1072881867 10:99236112-99236134 CCGGCACCGCCCCTTTAAGAGAT No data
Right 1072881878 10:99236157-99236179 CTTTTTAAAGGTAAGGGGAGGGG No data
1072881867_1072881877 21 Left 1072881867 10:99236112-99236134 CCGGCACCGCCCCTTTAAGAGAT No data
Right 1072881877 10:99236156-99236178 ACTTTTTAAAGGTAAGGGGAGGG No data
1072881867_1072881872 10 Left 1072881867 10:99236112-99236134 CCGGCACCGCCCCTTTAAGAGAT No data
Right 1072881872 10:99236145-99236167 GACATTTTTTAACTTTTTAAAGG No data
1072881867_1072881873 15 Left 1072881867 10:99236112-99236134 CCGGCACCGCCCCTTTAAGAGAT No data
Right 1072881873 10:99236150-99236172 TTTTTAACTTTTTAAAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072881867 Original CRISPR ATCTCTTAAAGGGGCGGTGC CGG (reversed) Intergenic
No off target data available for this crispr