ID: 1072883719

View in Genome Browser
Species Human (GRCh38)
Location 10:99254253-99254275
Sequence CTGCATCTATGTTGTTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072883719_1072883720 -6 Left 1072883719 10:99254253-99254275 CCATTGAAACAACATAGATGCAG No data
Right 1072883720 10:99254270-99254292 ATGCAGCTGTGAATTAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072883719 Original CRISPR CTGCATCTATGTTGTTTCAA TGG (reversed) Intergenic
No off target data available for this crispr