ID: 1072883810

View in Genome Browser
Species Human (GRCh38)
Location 10:99255822-99255844
Sequence GAAAATGGACTAATGCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072883810_1072883814 7 Left 1072883810 10:99255822-99255844 CCCAGTTGCATTAGTCCATTTTC No data
Right 1072883814 10:99255852-99255874 TATAAAGAACTGCCTGAGACTGG 0: 368
1: 1824
2: 4206
3: 5881
4: 9652
1072883810_1072883817 28 Left 1072883810 10:99255822-99255844 CCCAGTTGCATTAGTCCATTTTC No data
Right 1072883817 10:99255873-99255895 GGGTAAGTTATAAAGAAAACAGG No data
1072883810_1072883815 8 Left 1072883810 10:99255822-99255844 CCCAGTTGCATTAGTCCATTTTC No data
Right 1072883815 10:99255853-99255875 ATAAAGAACTGCCTGAGACTGGG 0: 375
1: 1800
2: 4209
3: 8914
4: 10953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072883810 Original CRISPR GAAAATGGACTAATGCAACT GGG (reversed) Intergenic
No off target data available for this crispr