ID: 1072884209 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:99259664-99259686 |
| Sequence | CTAGGTAAACACTCTAAGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072884205_1072884209 | 3 | Left | 1072884205 | 10:99259638-99259660 | CCAACATCAAAGACAACAGAAAT | No data | ||
| Right | 1072884209 | 10:99259664-99259686 | CTAGGTAAACACTCTAAGGCAGG | No data | ||||
| 1072884204_1072884209 | 30 | Left | 1072884204 | 10:99259611-99259633 | CCAAGATGTCATGAATAAAACAA | No data | ||
| Right | 1072884209 | 10:99259664-99259686 | CTAGGTAAACACTCTAAGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072884209 | Original CRISPR | CTAGGTAAACACTCTAAGGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||