ID: 1072884209

View in Genome Browser
Species Human (GRCh38)
Location 10:99259664-99259686
Sequence CTAGGTAAACACTCTAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072884205_1072884209 3 Left 1072884205 10:99259638-99259660 CCAACATCAAAGACAACAGAAAT No data
Right 1072884209 10:99259664-99259686 CTAGGTAAACACTCTAAGGCAGG No data
1072884204_1072884209 30 Left 1072884204 10:99259611-99259633 CCAAGATGTCATGAATAAAACAA No data
Right 1072884209 10:99259664-99259686 CTAGGTAAACACTCTAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072884209 Original CRISPR CTAGGTAAACACTCTAAGGC AGG Intergenic
No off target data available for this crispr