ID: 1072889127

View in Genome Browser
Species Human (GRCh38)
Location 10:99306271-99306293
Sequence GAGGGTAAAATGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072889127_1072889138 30 Left 1072889127 10:99306271-99306293 CCCTCCTCCTCCATTTTACCCTC No data
Right 1072889138 10:99306324-99306346 AGCCTGCATGCTCTCTCCTTTGG No data
1072889127_1072889132 -8 Left 1072889127 10:99306271-99306293 CCCTCCTCCTCCATTTTACCCTC No data
Right 1072889132 10:99306286-99306308 TTACCCTCTTGACCCATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072889127 Original CRISPR GAGGGTAAAATGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr