ID: 1072891562

View in Genome Browser
Species Human (GRCh38)
Location 10:99329565-99329587
Sequence GGCACCCTGCGCGCCGCCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072891548_1072891562 23 Left 1072891548 10:99329519-99329541 CCTGCGGCCCGAGGACACTGCTG 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1072891562 10:99329565-99329587 GGCACCCTGCGCGCCGCCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 65
1072891551_1072891562 16 Left 1072891551 10:99329526-99329548 CCCGAGGACACTGCTGGAGGCCG 0: 1
1: 0
2: 0
3: 20
4: 321
Right 1072891562 10:99329565-99329587 GGCACCCTGCGCGCCGCCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 65
1072891559_1072891562 -4 Left 1072891559 10:99329546-99329568 CCGCGTGTCCCTGGAGGGGGGCA 0: 1
1: 0
2: 1
3: 11
4: 175
Right 1072891562 10:99329565-99329587 GGCACCCTGCGCGCCGCCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 65
1072891552_1072891562 15 Left 1072891552 10:99329527-99329549 CCGAGGACACTGCTGGAGGCCGC 0: 1
1: 0
2: 0
3: 19
4: 189
Right 1072891562 10:99329565-99329587 GGCACCCTGCGCGCCGCCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072891562 Original CRISPR GGCACCCTGCGCGCCGCCGA AGG Exonic