ID: 1072894570

View in Genome Browser
Species Human (GRCh38)
Location 10:99355685-99355707
Sequence ACAGCCTGTAAGAGCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072894570 Original CRISPR ACAGCCTGTAAGAGCAAAGC TGG (reversed) Intronic
901448478 1:9322331-9322353 ATAGCCGGTAAGGGCAGAGCTGG + Intronic
902073289 1:13761041-13761063 ACAGCTTTTAAGAGAGAAGCAGG - Intronic
904474123 1:30753717-30753739 AAAGGATGTAAGAGGAAAGCTGG + Intronic
905211627 1:36378309-36378331 ACAGCCAGTAAGGGCAGAGCTGG - Intronic
905777561 1:40678929-40678951 AAAGCCTGAAGGAGCAAAGCTGG + Intergenic
906302923 1:44696848-44696870 AAAGCCTGTAAGAGCCAAGGTGG + Intronic
906326582 1:44849988-44850010 GCAGGCTGTAAAAGCAATGCAGG + Intergenic
907799964 1:57754774-57754796 ACAGCTAGTGAGAGCAGAGCTGG + Intronic
910909813 1:92221525-92221547 ACATGCTGTAAGAGCAAAGGTGG + Intronic
911740996 1:101386728-101386750 TGAGCCTGTAAAATCAAAGCAGG + Intergenic
912037424 1:105335979-105336001 ACAGTATCTAAGAGCAAAGGAGG + Intergenic
912163235 1:107011730-107011752 GCATCCTGTAAGGGCAGAGCAGG + Intergenic
915302465 1:154959381-154959403 ACAGCCTCCCAGAGCAGAGCTGG - Exonic
915706771 1:157851237-157851259 ACATACTGTAAGAGCAGAGTAGG - Intronic
920599562 1:207309953-207309975 AAAACCTGTGAGATCAAAGCAGG + Intergenic
922963147 1:229665177-229665199 ACAGGCAGTAAGAGAAAAGAGGG - Intergenic
923362391 1:233224523-233224545 ACAAACTGTAAGAGCTAGGCAGG - Intronic
1066637684 10:37522840-37522862 ACAGCCTAAAAGAGAACAGCTGG - Intergenic
1067699163 10:48556203-48556225 ACAGCCTGGAAGTGCAAGGCTGG - Intronic
1068255960 10:54511208-54511230 ACAGCATGCAAGAGCAGAACAGG - Intronic
1072808669 10:98443453-98443475 ACAGCCTGAAGTGGCAAAGCTGG + Intronic
1072829708 10:98644844-98644866 ACAGCTTGTAAGGGTAAAACTGG - Intronic
1072894570 10:99355685-99355707 ACAGCCTGTAAGAGCAAAGCTGG - Intronic
1073057442 10:100711441-100711463 AGAGCCTGTAAGAGAAAATGAGG + Intergenic
1073442358 10:103559589-103559611 ACAGCCAGCAAGAGCAGAACAGG - Intronic
1073461136 10:103666606-103666628 AGAGCTAGTAAGGGCAAAGCAGG - Intronic
1073613521 10:104968975-104968997 AATGCCTGTGAGGGCAAAGCAGG - Intronic
1073933915 10:108607484-108607506 TCATACTGAAAGAGCAAAGCTGG - Intergenic
1075944962 10:126424795-126424817 AGAGCTGGTAAGAGAAAAGCTGG - Intergenic
1076278339 10:129224613-129224635 CCAGCCTGTAAGAGCGGTGCTGG + Intergenic
1076759004 10:132590758-132590780 AATGCCAGAAAGAGCAAAGCAGG - Intronic
1077430381 11:2513249-2513271 ACAGCCAAGAAGAGCAAAGAGGG - Intronic
1078277950 11:9869077-9869099 ATAGCCTGTATTAGAAAAGCAGG + Intronic
1079408824 11:20167574-20167596 CCAGCCTCTCAGAGCAAAGCAGG - Intergenic
1079454033 11:20621977-20621999 ACAGCCTGTACGAGCTAATTAGG - Intronic
1079776118 11:24530489-24530511 ACAGAATGTGAGATCAAAGCAGG - Intronic
1080414677 11:32058178-32058200 ACAGGCTGTAAGAAAAAGGCAGG - Intronic
1082751156 11:57019355-57019377 ACAGCCAGAAAGAACAAAGGTGG + Intergenic
1082938225 11:58676223-58676245 CCTGCCTGTAACAGCACAGCAGG - Intronic
1083278080 11:61608802-61608824 ACACCCTGGGAGAGCAGAGCTGG - Intergenic
1085044413 11:73344777-73344799 ACAGCCAGTAAGGGCAGTGCTGG + Intronic
1085374625 11:76048190-76048212 CTAGCCTGTAAGAGCAAATGTGG + Intronic
1085804199 11:79619470-79619492 ACACCCAGGAAGAGCAAGGCAGG - Intergenic
1086486769 11:87312566-87312588 TCAGACTGTAACAGCAGAGCTGG - Intronic
1087701644 11:101442147-101442169 ACAGCCTGGAAGAGAAAAGGTGG - Intergenic
1090047898 11:123351806-123351828 ACAGCGAGTAAGAGCAGAGTGGG - Intergenic
1094218402 12:27969725-27969747 ACAGCCAGAAAGAGCAAAAAGGG + Intronic
1096811393 12:54172733-54172755 ACATCCTTTAGGAGCAGAGCAGG - Intronic
1096983197 12:55740752-55740774 AAAGGCTGTGAGAGCAAAGTTGG - Intergenic
1099104129 12:78479078-78479100 ACAGACTGAAAGAGCAAATGAGG + Intergenic
1101806148 12:108065561-108065583 ACAGCTAGAAAGAGCAGAGCTGG - Intergenic
1103533116 12:121616243-121616265 ACATCCTCTATTAGCAAAGCAGG - Intergenic
1103559061 12:121782785-121782807 ACAGCCAGTGAGGGCAGAGCTGG - Intronic
1103899389 12:124295464-124295486 ACAGCCTGAAGGAGCAGGGCCGG + Intronic
1105582002 13:21706834-21706856 AAACCCTGCAAGACCAAAGCTGG - Intergenic
1107480997 13:40786228-40786250 ACAGGCGCTAAGAGAAAAGCAGG - Intergenic
1107716535 13:43205208-43205230 AAAGGTTGTAAGAACAAAGCAGG + Intergenic
1108151941 13:47545202-47545224 ACAGCCTGGACAAGCAAAGATGG - Intergenic
1113664467 13:112131712-112131734 TCAGCCTGCAAGAGCAAAGCAGG - Intergenic
1113883608 13:113645061-113645083 ACAATCTTGAAGAGCAAAGCTGG + Intergenic
1115118568 14:29911961-29911983 ATAGGCTGTAAGAGGAAAGCAGG - Intronic
1119262089 14:73243965-73243987 ACAGCCTGAAAGAGTACAGGAGG + Intronic
1121554919 14:94829190-94829212 ACAGACTGGAAGGGCACAGCTGG - Intergenic
1124409037 15:29420402-29420424 ACAGTCTGTAGCAGCACAGCAGG + Intronic
1124897138 15:33787982-33788004 ATGGCCTGGAAGAGCAGAGCAGG + Intronic
1125380211 15:39079360-39079382 GCAGGCTGTCAGAGGAAAGCAGG + Intergenic
1128358506 15:66944492-66944514 CCTGCCTGTAAGAGCTCAGCGGG + Intergenic
1128637854 15:69314637-69314659 CCAGCCTGCAAGAGCACGGCTGG - Intronic
1129445252 15:75612515-75612537 ACAGCATCTAAGAGAAAAGGGGG - Intronic
1132423987 15:101698456-101698478 ACAGCCAGGCAGAGCAAAACTGG + Intronic
1134782970 16:16915641-16915663 ACAGCTGGTAAGAGCAGAGCCGG + Intergenic
1134833444 16:17342379-17342401 AGAGCATGGGAGAGCAAAGCAGG - Intronic
1136375627 16:29863547-29863569 AGAGCCTGCGAGAGCAAAGGCGG - Exonic
1138639153 16:58369040-58369062 ACAGCCTCTGAGAACTAAGCAGG + Intronic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1139730341 16:68938904-68938926 ACAAGCAGTAAGAACAAAGCCGG + Intronic
1140441785 16:74993461-74993483 GCAGCTAGTAAGAGCAGAGCTGG - Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1144623647 17:16833553-16833575 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1144882782 17:18439163-18439185 ACAGCTGGTAAGGGCAGAGCAGG + Intergenic
1145149449 17:20505223-20505245 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1147268226 17:39247748-39247770 ACCACCTGTAAGAGTGAAGCGGG - Intergenic
1147841892 17:43377641-43377663 AGAGCCTGTCAGAGCGAGGCTGG - Intergenic
1149570784 17:57670980-57671002 CCTGACTGTAAGAGCAGAGCTGG + Intronic
1150034213 17:61776176-61776198 AAAGTCTGAAAGAGCAAGGCTGG - Intronic
1150612771 17:66747562-66747584 ATAGCTGGTAAGAGCAAAGGTGG + Intronic
1150785008 17:68155030-68155052 ACAGCCTGAAATAACAAAGCAGG - Intergenic
1150863019 17:68820881-68820903 ACAGTTTGTAAAAGCAGAGCCGG - Intergenic
1151766314 17:76135196-76135218 CCAGCCTGTCAGTCCAAAGCTGG + Intergenic
1156439544 18:37170300-37170322 CCAGCTGGTAAGAGCAAAGCTGG - Intronic
1157350958 18:46884955-46884977 ACTGCCTGTGAGAGCACATCAGG + Intronic
1158007785 18:52692730-52692752 ACAGCCTCTAAAAGAGAAGCTGG - Intronic
1159600944 18:70428141-70428163 ACAGCCTTTAAATGAAAAGCAGG - Intergenic
1160918985 19:1510975-1510997 ACAGCCAGTCAGGGCAGAGCCGG - Exonic
1162136340 19:8557714-8557736 GCAGGCTGTAGGAGCAGAGCAGG + Intronic
1163422330 19:17220803-17220825 ACAGCCTGTGAGAGCAACTGAGG + Intergenic
1163678504 19:18667532-18667554 ACAGCCAGCAAGAGGAAAGTAGG - Intronic
1164591159 19:29507704-29507726 AGAGCCTCCAAGAGCAGAGCGGG + Intergenic
1164730199 19:30497830-30497852 TCAGCCTGTAAGACCCAAGCAGG + Intronic
1164923593 19:32108422-32108444 ACAGCCAGTGAGAACAAAACGGG + Intergenic
1165075217 19:33276587-33276609 ACAGCCAGTGAGACCAGAGCTGG - Intergenic
1166479056 19:43154067-43154089 ACTTCCTGTAAGAGGAAACCAGG + Intronic
1168050941 19:53829407-53829429 ACTGCCTGTAAAAGCAAATCAGG - Intergenic
1168666316 19:58207697-58207719 ACTGCCTGTAAGGGCCAAGATGG + Intronic
925571068 2:5313468-5313490 ACACCCTCTAAGAGCAGGGCAGG + Intergenic
926436106 2:12839703-12839725 ACAGCTTCTAATAGCAAAGATGG + Intergenic
926694135 2:15758841-15758863 ACAGCCAGCAAGAGCAGAGCTGG - Intergenic
927277390 2:21273401-21273423 TCAGCTTGTACGAGTAAAGCAGG - Intergenic
927759625 2:25741229-25741251 ACAGCCTGTAACAACACAGGGGG + Intronic
929410441 2:41693139-41693161 ACAGCTTGTAAGAGTAATGTGGG - Intergenic
929606298 2:43236485-43236507 CCAGCCTGTAAGAGCCTAGCTGG - Intronic
930328972 2:49958408-49958430 ACAGACTGTAAATGCAAGGCTGG - Intronic
930599029 2:53423221-53423243 ACAGCCTGAGAGTGCCAAGCTGG - Intergenic
931563320 2:63588105-63588127 ACAGCGGATAAAAGCAAAGCGGG + Intronic
932819190 2:74885153-74885175 ACAGCTTGGAAGAGAGAAGCAGG - Intronic
935233105 2:101116482-101116504 TCAGCCTGTAAGAGGCAAGTGGG - Intronic
936533308 2:113291702-113291724 ACTGCTTGTTAGAGAAAAGCGGG + Intergenic
938770134 2:134494770-134494792 ACAGCCAGTTAGAGCATGGCAGG + Intronic
940255818 2:151727789-151727811 ACAGCCAGCATCAGCAAAGCCGG - Exonic
941808986 2:169737085-169737107 TCAGCAAGTAAGAGGAAAGCAGG - Intronic
942438082 2:176002522-176002544 ACAGGCTTTAAAAGCAAAGGAGG - Intronic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
1170635599 20:18101507-18101529 ACAGCCTGTAGGTGGAAAGTGGG + Intergenic
1172627773 20:36358051-36358073 ACAGCCAGTGACAGCAGAGCTGG - Intronic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1173088005 20:39942890-39942912 ACAGCATGTAACAGCAATGGAGG + Intergenic
1173354642 20:42275797-42275819 ACAGTCAGTGAGAGCAAAGGGGG + Intronic
1175592272 20:60202515-60202537 ACAGACTGAAAGAGGAAAGCTGG - Intergenic
1179042586 21:37816921-37816943 ACAGCTTGTAGGAGCAAATGTGG - Intronic
1179272931 21:39865677-39865699 ACAGCCTGGAGGACCACAGCAGG + Intergenic
1179321115 21:40291844-40291866 ACAGCCAGAGAGAGCAAAGGAGG + Intronic
1183009370 22:34932246-34932268 GCAGCCTGTAAGTGCAGAGCTGG - Intergenic
949960922 3:9311683-9311705 ACAGCCTGTAAGTTCTAAGAAGG - Intronic
951982989 3:28586252-28586274 ACAGCCTGTAGAAACAAAACTGG - Intergenic
952800635 3:37287599-37287621 ACAGCTTGTAAGAGGTAAGGAGG + Intronic
952920165 3:38278473-38278495 ACAGGTTGTAGGAGCAATGCTGG - Intergenic
955991768 3:64635269-64635291 CCAGCTTGTAACTGCAAAGCTGG - Intronic
956223610 3:66931405-66931427 ACAGCCTGTCAGATAAAAGCTGG - Intergenic
956707267 3:72010178-72010200 TCAGCATCTTAGAGCAAAGCAGG + Intergenic
961801646 3:129455116-129455138 GCAGACTTAAAGAGCAAAGCTGG - Intronic
962843159 3:139253278-139253300 ACAGCAAGTGAGAGCAGAGCTGG + Intronic
963417910 3:145022576-145022598 ACAACCTGTTACAGCAAAACAGG - Intergenic
965904651 3:173689048-173689070 GCAGCCAGTAAGAGCAGATCTGG - Intronic
967303573 3:188039640-188039662 CCAGCCAGAAAGAGAAAAGCTGG - Intergenic
970017103 4:11524142-11524164 TCAGCCTGTAGGAGCAGATCGGG - Intergenic
971960844 4:33485259-33485281 ACAGCCAGGAAGGGCAAAGCTGG + Intergenic
972636279 4:40886781-40886803 ACAGCAGGCAGGAGCAAAGCAGG + Intronic
973645488 4:52947066-52947088 AAAGCCTGTAAGAACAGTGCAGG - Intronic
977822496 4:101490519-101490541 ACAGCCAAAAAGAGCAAAGATGG - Intronic
980464365 4:133153019-133153041 ACAGGATGGAAGAGCAAAGGAGG - Intronic
981569460 4:146136027-146136049 ACAGAATGTAACAGCAGAGCAGG - Intergenic
981832830 4:149021816-149021838 ACCCACTGTAAGAGGAAAGCAGG - Intergenic
984539071 4:181014615-181014637 ATATCCTGTCAGAGCAAAACAGG + Intergenic
985039071 4:185870634-185870656 GCTGCCTGAGAGAGCAAAGCCGG - Intronic
985567311 5:625811-625833 ACGGCCTGTGAGAGCAGGGCTGG - Intronic
985937749 5:3109760-3109782 ACAGCCTGTCTGGGAAAAGCTGG + Intergenic
988413693 5:30918581-30918603 ACAGACTGTAAGTGCACAGTTGG - Intergenic
988789921 5:34598229-34598251 TCAGCCTGGAACTGCAAAGCAGG - Intergenic
990032774 5:51282363-51282385 GGAGCCTGTGAGAGCAAAACTGG - Intergenic
991429552 5:66530049-66530071 ACAGCCTATAAGAGAAGAGGTGG - Intergenic
992621086 5:78593761-78593783 ACAGCCTAGAGGAGCAAGGCTGG + Intronic
993159061 5:84265231-84265253 ACAGCATGTAAAAGCCAAACGGG + Intronic
994147824 5:96414158-96414180 ACAGCTGGTAAGAGCAGAACTGG - Intronic
994647486 5:102489155-102489177 TCAGCCTGCAGGAGCAAAGTGGG + Intronic
995754707 5:115490880-115490902 AAAGCCTGTGAGAGCAGATCAGG - Intergenic
1001209355 5:169795773-169795795 GCAGCCTGGCAGAGCAGAGCTGG + Intronic
1002360577 5:178667569-178667591 ACTGCCTGAATGAGGAAAGCTGG + Intergenic
1003638378 6:7855486-7855508 ACAGCCAGCAAGGGCAGAGCTGG - Intronic
1005374314 6:25166498-25166520 ACAGCAGGCAAGAGCACAGCAGG + Intergenic
1006342830 6:33456003-33456025 TCAGCCTGGAGGAGCAAAGGAGG + Exonic
1006473130 6:34239034-34239056 ACTGCCTGTAATTGCAGAGCAGG + Intronic
1006717230 6:36128342-36128364 ACAGCTGGTAAGGGCAGAGCTGG - Intronic
1007586353 6:42992399-42992421 AATGCCTGACAGAGCAAAGCTGG - Intronic
1007847082 6:44768165-44768187 AGAGTCTGGAAGAGCAAAACGGG + Intergenic
1010025145 6:71206409-71206431 AAGGACTGTAAAAGCAAAGCAGG + Intergenic
1015262608 6:131255670-131255692 ACAGGATGTAATAGCAGAGCTGG - Intronic
1016996596 6:149965630-149965652 ACAGCAGGTCAGAGCAGAGCAGG - Intronic
1017306234 6:152921835-152921857 TGAGCCTGTGAGAGCAGAGCAGG + Intergenic
1019851285 7:3560775-3560797 AGAGGCTGGAAGAGCAGAGCTGG - Intronic
1020407589 7:7854844-7854866 TGAGCCTGTAAAATCAAAGCAGG + Intronic
1022144552 7:27524078-27524100 AGAGTCTGTAGGAGCAAGGCTGG - Intergenic
1022470437 7:30678832-30678854 GCAGGCTGTAAGAGCAAATGAGG - Intronic
1025284380 7:57650338-57650360 ACAGTCTGTAAGAAGAAACCAGG - Intergenic
1028649927 7:93140070-93140092 ACAGCTTGTCAGAGCATGGCTGG + Intronic
1034883471 7:154779676-154779698 ACAGCCTGAGGGAGGAAAGCAGG - Intronic
1035185440 7:157122688-157122710 ACTGCCTGTATGAGCAAGTCAGG - Intergenic
1035989929 8:4478131-4478153 AGTGCCTGTAACAGCAAAGATGG + Intronic
1036436540 8:8739461-8739483 ACAGCATGTAAGTGTGAAGCTGG - Intergenic
1036563658 8:9919564-9919586 TCACCCTTTAAGAGAAAAGCAGG - Intergenic
1037377845 8:18251069-18251091 ACAGGCTGTATGAGGAAAGCTGG - Intergenic
1037974863 8:23201859-23201881 ACAGCATGTCAGTGCAAACCAGG - Exonic
1039599120 8:38819354-38819376 ACAGCCTGAAAGAGAAGAGCTGG - Intronic
1043667336 8:82832384-82832406 ACAGCTTGTGAGAGCCAAGAAGG - Intergenic
1044343613 8:91076631-91076653 ACAGCTGGTAAGAGCAGAGCAGG - Intronic
1044604767 8:94039165-94039187 CCAACCTGTCAGAGCAAAGAGGG + Intergenic
1044693375 8:94900137-94900159 ACAGCCTGGCAGAGACAAGCAGG - Intronic
1048386073 8:133913699-133913721 CCAGCCTGTGAAAGCAAAGCTGG + Intergenic
1048743956 8:137592408-137592430 ACAGCTTGAAAGGGCAGAGCTGG - Intergenic
1051245585 9:15107819-15107841 ACAGCCAGCAAGAGCAAAATAGG + Intergenic
1053160475 9:35810382-35810404 ACAGCCTGTCAGAGCCCAGCTGG + Intronic
1053304169 9:36972332-36972354 ACAGCAAGTAACAGCAGAGCTGG - Intronic
1059936733 9:119319278-119319300 ACAGGCCCTAAGAACAAAGCAGG - Intronic
1202803685 9_KI270720v1_random:28116-28138 ACAGACTGTAAGAGAACAGTGGG - Intergenic
1186232067 X:7466224-7466246 ACAGCCTGTCACAGCAAGGAAGG + Intergenic
1186474989 X:9850256-9850278 ACAGCTTGTAGCAGAAAAGCAGG - Intronic
1187527116 X:20064274-20064296 ACAGCCTGCAAGAGGCAAGACGG + Intronic
1192235654 X:69294006-69294028 ACAGCCTCTAAAAACAAAGCAGG - Intergenic
1198581097 X:138065437-138065459 ACAGCTAGTAAGAACAGAGCTGG + Intergenic
1201589450 Y:15598763-15598785 ACAGCATATAAAAGCAAATCTGG - Intergenic