ID: 1072895402

View in Genome Browser
Species Human (GRCh38)
Location 10:99362220-99362242
Sequence TTAAAGGGCTCCACTTCTAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072895402_1072895407 11 Left 1072895402 10:99362220-99362242 CCTCTAGAAGTGGAGCCCTTTAA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1072895407 10:99362254-99362276 TTTCGGAGAAGATCCTGCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 90
1072895402_1072895405 -6 Left 1072895402 10:99362220-99362242 CCTCTAGAAGTGGAGCCCTTTAA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1072895405 10:99362237-99362259 CTTTAAGTCTCTGTACCTTTCGG 0: 1
1: 0
2: 0
3: 18
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072895402 Original CRISPR TTAAAGGGCTCCACTTCTAG AGG (reversed) Exonic
906043911 1:42812845-42812867 TTAAAGAGCTCTATTTGTAGAGG - Intronic
906526314 1:46495180-46495202 TTGAAGGGCTCAGATTCTAGGGG - Intergenic
907810387 1:57863984-57864006 TCAAAGTGCTCCCATTCTAGTGG + Intronic
908798884 1:67858582-67858604 CTAAGGGGCTACAATTCTAGGGG - Intergenic
910838905 1:91542462-91542484 TAAAAGGGTTCCATATCTAGGGG - Intergenic
911933564 1:103936301-103936323 TTAAAGGGAACCACTTCTACCGG - Intergenic
915097042 1:153470457-153470479 TTACAGGGCTCTCCTGCTAGAGG - Intergenic
915127153 1:153673884-153673906 TCAAAAGGCTGCACTCCTAGGGG - Intergenic
919390968 1:196985382-196985404 TAAAAAGACTCCATTTCTAGAGG - Intronic
1063042452 10:2357382-2357404 GTAAAAGGCTCCACTTCCAGAGG + Intergenic
1063943816 10:11157952-11157974 TTAAAGGGACCCACATCAAGGGG - Intronic
1064576643 10:16752570-16752592 TTAAAGAGCTCCACATTCAGGGG - Exonic
1067013481 10:42737103-42737125 TTAAAGAGCTCCACATTCAGGGG + Intergenic
1067310300 10:45106647-45106669 TTAAAGAGCTCCACATTCAGAGG - Intergenic
1067699234 10:48556774-48556796 TATAAGGGCTCCACACCTAGTGG + Intronic
1072895402 10:99362220-99362242 TTAAAGGGCTCCACTTCTAGAGG - Exonic
1073952217 10:108822865-108822887 TTAAAGGACTTCACTTCTGAGGG - Intergenic
1078870831 11:15343059-15343081 TTAAAGGGCTTCCCTGCTAAAGG - Intergenic
1086448612 11:86893860-86893882 TTAAAGTACCCCACTTATAGAGG + Intronic
1091896912 12:4112610-4112632 TTAAAAAGCTTTACTTCTAGTGG - Intergenic
1091984249 12:4895150-4895172 TTAAAGTGCTAGGCTTCTAGAGG - Intergenic
1094761192 12:33534915-33534937 TTAAGGAGCTCCAGGTCTAGTGG + Intergenic
1096494215 12:52029993-52030015 TTATAAGTGTCCACTTCTAGGGG - Intronic
1096614989 12:52827141-52827163 TGGAAGGGCTAGACTTCTAGAGG - Intronic
1099006953 12:77245330-77245352 TTAAAAGGCTCAACTTTCAGGGG - Intergenic
1099751744 12:86782725-86782747 TTAAAGGACACCAGTTCTACTGG - Intronic
1104768895 12:131347590-131347612 CAAAAGGGCTGCACTTCTCGGGG + Intergenic
1107566507 13:41610846-41610868 TTAAATGGCTCCTATTGTAGTGG + Intronic
1113851030 13:113418221-113418243 AAAAAGGGCCCCGCTTCTAGTGG + Intergenic
1115735511 14:36324084-36324106 TCAAAGAGCTCCCGTTCTAGTGG + Intergenic
1116197516 14:41748425-41748447 TTATAGGACTCCACTTATAGAGG + Intronic
1119261611 14:73241116-73241138 TCTATGGGATCCACTTCTAGTGG - Intronic
1119350266 14:73958809-73958831 TGCAGGGGCTCCACCTCTAGGGG + Intronic
1121264005 14:92587352-92587374 TGAAAGGGCTTCCCTTCTTGTGG - Intronic
1127983212 15:64049191-64049213 TTCAAGTGCTTCACTTCTAGGGG + Intronic
1128406263 15:67342808-67342830 TTACTGGGCCCCAATTCTAGTGG + Intronic
1136095253 16:27950980-27951002 TTGAAGAGCTCATCTTCTAGTGG - Intronic
1141685754 16:85568958-85568980 TTAAAGGGACTCATTTCTAGGGG - Intergenic
1145233471 17:21191862-21191884 TTTAATGGTTTCACTTCTAGAGG - Exonic
1150539567 17:66082984-66083006 TTAAATAGCTCCATTTCTAAAGG + Intronic
1151469154 17:74307152-74307174 GTAAAGGGCTTCACATCTACTGG - Intronic
1151685976 17:75646849-75646871 ATAAGGAGCTCCGCTTCTAGAGG + Intronic
1153738385 18:8096727-8096749 TTTAAGGGATGAACTTCTAGAGG + Intronic
1155273345 18:24162370-24162392 TTAAATGCTTCCACTTCCAGTGG - Exonic
1155871842 18:31040197-31040219 TAAAAGGGCTCCTCTTCTAAAGG - Intronic
1156103601 18:33629108-33629130 TTAAAGGGCTTTACTTCTTTTGG - Intronic
1158049133 18:53194352-53194374 TTAAAAGGCTCCATTTATATCGG + Intronic
1160079168 18:75706362-75706384 TTAAAGGGCTCCAATACTTTAGG + Intergenic
934895953 2:98120169-98120191 TGAAAGGGGTCAACTTATAGGGG - Intronic
940623973 2:156149624-156149646 TTAATGGGCTCCAATTTCAGTGG - Intergenic
943715869 2:191151452-191151474 TTACTGGGCTCCAATTCCAGCGG + Intronic
1170563426 20:17578337-17578359 TTAAAGGACTCCACCTCCATGGG - Intronic
1171294425 20:24005096-24005118 GTAAAGGGGTCTACTTCCAGGGG - Intergenic
1177043272 21:16139313-16139335 TTAAATGGCTCCAATTCTGCAGG + Intergenic
1182585032 22:31340042-31340064 TCCACGGGCTCCACTTCTTGGGG - Intronic
1184872109 22:47247370-47247392 TTAAACTGCTCCACTTATAATGG - Intergenic
952510044 3:34043849-34043871 TTAAAGGGCACCACTGCCAATGG - Intergenic
955805716 3:62731929-62731951 TTACATGGCTCCACCTCTAAGGG - Intronic
960494603 3:118359794-118359816 TTATATGGCACCATTTCTAGGGG - Intergenic
965490933 3:169334993-169335015 TAAAAGGGCTCCAGTTCTGCTGG + Intronic
967034561 3:185638576-185638598 TCAAAGGGGTCCACTTTTGGAGG + Intergenic
975492246 4:75002080-75002102 TTAAAGGGCTCCAGCTCTCTGGG + Intronic
978276218 4:106953701-106953723 TTAAAGTGTTCCACTTCTGAAGG - Intronic
981527295 4:145719667-145719689 TTAAAGTGTTGCAATTCTAGGGG - Intronic
981659028 4:147144852-147144874 TTAAAGCCATACACTTCTAGTGG + Intergenic
985515246 5:340514-340536 TTATAGGGCACCAGTTCTACAGG + Intronic
986895943 5:12368334-12368356 TATAAGGACTCCAGTTCTAGTGG - Intergenic
989219834 5:38944996-38945018 TTAGAGGGAACCACTTCTAAAGG + Exonic
998443945 5:142184471-142184493 ATAAACGGCCCCACTGCTAGAGG - Intergenic
1008371718 6:50739595-50739617 TTAAATGGCTCCACTGATAGAGG + Intronic
1017536500 6:155352569-155352591 TTAAAGGGCTTCACCTCAAAGGG + Intergenic
1020633938 7:10673291-10673313 TTAAAGTTATCCATTTCTAGGGG - Intergenic
1022256315 7:28662075-28662097 AAAAAGGGCTGCTCTTCTAGCGG + Intronic
1022366400 7:29723493-29723515 TTATAAGGCTCCACTTAGAGGGG + Intergenic
1029806755 7:103005672-103005694 TAAAAGGGCGCCAGTTCTACTGG + Intronic
1031178719 7:118387503-118387525 ATAATGGGCTCCACTTTAAGGGG + Intergenic
1034968064 7:155403716-155403738 TTAAAGGGCTTTACTCCCAGGGG + Intergenic
1042671966 8:71274233-71274255 TTGCAGGCCTCCACTTCTGGAGG + Intronic
1049589651 8:143451470-143451492 TAAAACGGATCCACTTCTGGGGG + Intronic
1050114521 9:2249905-2249927 TTCAAGGGTTCCTCCTCTAGCGG + Intergenic
1052106807 9:24528586-24528608 TATAATGGCTCCATTTCTAGGGG - Intergenic
1054755050 9:68949322-68949344 CTTCAGGGCTCCATTTCTAGAGG - Intronic
1058621698 9:106889801-106889823 TTAAAACGCACCACTTCTAGTGG - Intronic
1058658449 9:107246962-107246984 TGAAAAGGGGCCACTTCTAGGGG - Intergenic
1058779255 9:108316990-108317012 ATAAAGAGCTCCAGTTCTAAGGG + Intergenic
1190092278 X:47450033-47450055 TTGAAGGGCTCCACTCATAATGG - Intronic
1191579334 X:62742833-62742855 TCTATAGGCTCCACTTCTAGGGG + Intergenic
1195011621 X:100737783-100737805 TTAAAGTGCTTCACATGTAGTGG - Intergenic
1197112334 X:122790998-122791020 ATAAAAGGCTCCACTTTTACTGG + Intergenic
1198605180 X:138329765-138329787 TTTAAGGGCACCAGTTGTAGTGG - Intergenic
1202045636 Y:20735008-20735030 TTCAAAGGCTCCACTCCCAGTGG + Intergenic