ID: 1072896046

View in Genome Browser
Species Human (GRCh38)
Location 10:99367830-99367852
Sequence GTGTCTGGGCAGGGGAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 240}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072896046_1072896062 28 Left 1072896046 10:99367830-99367852 CCATAGTTCCCCTGCCCAGACAC 0: 1
1: 0
2: 0
3: 22
4: 240
Right 1072896062 10:99367881-99367903 ATACACACTGAACTCTACCCGGG No data
1072896046_1072896058 -5 Left 1072896046 10:99367830-99367852 CCATAGTTCCCCTGCCCAGACAC 0: 1
1: 0
2: 0
3: 22
4: 240
Right 1072896058 10:99367848-99367870 GACACCACTTGAAGGGGGAGGGG No data
1072896046_1072896060 -1 Left 1072896046 10:99367830-99367852 CCATAGTTCCCCTGCCCAGACAC 0: 1
1: 0
2: 0
3: 22
4: 240
Right 1072896060 10:99367852-99367874 CCACTTGAAGGGGGAGGGGCTGG No data
1072896046_1072896053 -10 Left 1072896046 10:99367830-99367852 CCATAGTTCCCCTGCCCAGACAC 0: 1
1: 0
2: 0
3: 22
4: 240
Right 1072896053 10:99367843-99367865 GCCCAGACACCACTTGAAGGGGG No data
1072896046_1072896057 -6 Left 1072896046 10:99367830-99367852 CCATAGTTCCCCTGCCCAGACAC 0: 1
1: 0
2: 0
3: 22
4: 240
Right 1072896057 10:99367847-99367869 AGACACCACTTGAAGGGGGAGGG No data
1072896046_1072896056 -7 Left 1072896046 10:99367830-99367852 CCATAGTTCCCCTGCCCAGACAC 0: 1
1: 0
2: 0
3: 22
4: 240
Right 1072896056 10:99367846-99367868 CAGACACCACTTGAAGGGGGAGG No data
1072896046_1072896061 27 Left 1072896046 10:99367830-99367852 CCATAGTTCCCCTGCCCAGACAC 0: 1
1: 0
2: 0
3: 22
4: 240
Right 1072896061 10:99367880-99367902 TATACACACTGAACTCTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072896046 Original CRISPR GTGTCTGGGCAGGGGAACTA TGG (reversed) Intronic
900956904 1:5891920-5891942 GTGTCCGGACAGGGGACCTAGGG + Intronic
901070358 1:6513903-6513925 GTTTCTGTGCAGGGCAGCTATGG + Intronic
901121168 1:6895302-6895324 GTGTCTGGGATGGGGAAAAAAGG - Intronic
901144462 1:7055773-7055795 GTGCCTGGGCAGGTAAACTCCGG - Intronic
902249750 1:15146480-15146502 GGGTCTGGACAGAGGATCTAAGG - Intergenic
902393010 1:16116990-16117012 GTGTCAGGTCTGGGGATCTAAGG + Intergenic
903015150 1:20356731-20356753 GGGGCTGGGCAGGGGAGCCAGGG - Intergenic
904313568 1:29645300-29645322 GCATCTGGGCAGGGGAACAGCGG - Intergenic
904561356 1:31399636-31399658 GTTTCTGGGGAGGGGACCTGAGG + Intergenic
904924620 1:34037638-34037660 GTGTCTGGGAAGGGCACCCAAGG - Intronic
905105184 1:35559605-35559627 GTGGCTGGGGAGGGGTCCTAGGG + Intronic
905288487 1:36904059-36904081 GTGTGTGGGCAGGGGGTATATGG + Intronic
905478439 1:38245076-38245098 ATGTCAGGGCTGGGGGACTAGGG + Intergenic
906701112 1:47858901-47858923 CTTTCTGGGCATGGGAACCATGG + Intronic
907910587 1:58822476-58822498 AAGTCTGGGCCTGGGAACTATGG - Intergenic
908562586 1:65321580-65321602 GTGTAGGGGCAGGGGATATATGG - Intronic
908674764 1:66591504-66591526 GTGTAGGGGCAGGGGATATATGG - Intronic
909466883 1:75982598-75982620 GTGCCTGGGCAGGGTAACTGGGG + Intergenic
912573098 1:110638995-110639017 GTGTATGTGCAGTGGAATTAGGG - Intergenic
912799964 1:112714499-112714521 GTGGAGGGGGAGGGGAACTACGG + Intronic
915331643 1:155116482-155116504 GAGTTTGGGCAGGGGGAATAGGG - Intergenic
915719270 1:157972273-157972295 GTGTCTGGGCCCAGGAGCTAGGG - Intergenic
915731788 1:158059118-158059140 GTGTCTGGGCAAGGGATCCCAGG + Intronic
920400471 1:205673060-205673082 GTGTGTGGGCAGGTGAAGGATGG - Intronic
920911687 1:210223997-210224019 GTGTCAGGAGAGGGGAACTAAGG - Intergenic
921358574 1:214308967-214308989 GTGTCTGGCCAAGGCAACAATGG - Intronic
922057207 1:222052695-222052717 GTCTCTGGGAAGGGGAACATTGG + Intergenic
922892346 1:229071764-229071786 GTTCCTGGTCATGGGAACTATGG + Intergenic
923654383 1:235902911-235902933 GTGTACCTGCAGGGGAACTAAGG + Intergenic
924074023 1:240314265-240314287 GTGTTTTGGGAGGGGAAATATGG + Intronic
924165428 1:241276960-241276982 GTCTCTGGGCAGAGGTACGAAGG - Intronic
1064126742 10:12668470-12668492 CTTTCTAGCCAGGGGAACTAGGG + Intronic
1064973509 10:21089752-21089774 TTATCTGGGCAGGGGAAGGAGGG - Intronic
1067679913 10:48427324-48427346 GTGTCTGGGGTGGGAAACTTGGG - Intronic
1068151517 10:53138381-53138403 GTGTCTTGTCAGGGGAACAATGG - Intergenic
1069025892 10:63541001-63541023 ATTTCTGGGCAGTGGATCTAGGG + Intronic
1071097647 10:81997326-81997348 GTGCCTGTGCAGGGTCACTATGG + Intronic
1072581180 10:96741279-96741301 GTGTGTGGACAGGGGAAATGGGG - Intergenic
1072896046 10:99367830-99367852 GTGTCTGGGCAGGGGAACTATGG - Intronic
1074438687 10:113456207-113456229 GTGTGGGGGCAGGGAACCTAAGG - Intergenic
1075846861 10:125551828-125551850 GTGTCTGGGCTGGACACCTAAGG + Intergenic
1076316741 10:129547318-129547340 GTGTATGGACAGAGGGACTAGGG - Intronic
1080167060 11:29251247-29251269 GTGTAGGGACAGGGGAAATATGG + Intergenic
1080397748 11:31905506-31905528 GTGTGAGGGCAGGGGAGATATGG - Intronic
1083597211 11:63923733-63923755 GGGTCTGGGCTGGGGAAGGAGGG - Intergenic
1084519711 11:69655799-69655821 GTGTCAGGGCTGGGGTCCTAGGG + Intronic
1084945705 11:72637235-72637257 GTGTGTGGGGAGGGCAACGAGGG - Intronic
1086099908 11:83088357-83088379 GCCTCTGGGCAGGAAAACTAAGG + Intergenic
1087015317 11:93549067-93549089 GTCTCAGGGCAGGAAAACTAAGG - Intergenic
1090185879 11:124738911-124738933 GAGGCTGGGAAGGGGAGCTATGG - Intergenic
1090493587 11:127188323-127188345 GGGGCTGGACAGGGGTACTAGGG + Intergenic
1096353967 12:50924558-50924580 GGGTTTGGGCGGGGGAAGTAAGG + Intronic
1097405844 12:59188711-59188733 GTGTCTCGGCAGGGGAAATGGGG + Intergenic
1100854462 12:98746396-98746418 GTGTCTGGAGAAGGGAACTCGGG - Intronic
1102522201 12:113485460-113485482 GGGGCTGGGCAGGGGAACCTGGG - Intergenic
1104439509 12:128783290-128783312 GTTTCAGGCCAGGAGAACTAAGG - Intergenic
1104651950 12:130541223-130541245 GTTTCAGGGCAGGGGAAGTGAGG - Intronic
1104685576 12:130782171-130782193 GTGACAGGGTAGGGGAACCAGGG - Intergenic
1104754490 12:131260528-131260550 GGGTCTGGGCCCAGGAACTACGG + Intergenic
1106473183 13:30076114-30076136 GTGTAAGGGGAGGGGAGCTAGGG + Intergenic
1107882725 13:44846887-44846909 GTGTGTGTGCAGGGGATATATGG - Intergenic
1108527289 13:51296723-51296745 GGGCCTGGGCAAGGGAACTCTGG + Intergenic
1108682174 13:52790029-52790051 GTGGCTCGGCAGAAGAACTAAGG - Intergenic
1114542095 14:23468576-23468598 GTATCTGGGCAGGTGAGGTAAGG - Intergenic
1117617047 14:57544754-57544776 CTCTCTGGCCAGGGGATCTATGG - Intergenic
1122007724 14:98719081-98719103 GTGTCTGGACAGGGGTACCTGGG + Intergenic
1123474013 15:20576121-20576143 GTGACTGGGAAGGGGAGATAGGG - Intergenic
1123643997 15:22424232-22424254 GTGACTGGGAAGGGGAGATAGGG + Intergenic
1123734313 15:23171133-23171155 GTGACTGGGAAGGGGAGATAGGG - Intergenic
1124284818 15:28392441-28392463 GTGACTGGGAAGGGGAGATAGGG - Intergenic
1124297879 15:28519173-28519195 GTGACTGGGAAGGGGAGATAGGG + Intergenic
1126157144 15:45576248-45576270 GTGTATGAGCAGGGGACATAGGG + Intergenic
1128063198 15:64748146-64748168 GTGCCTGGGCAGGGGTGCTTGGG + Intronic
1128222933 15:65981724-65981746 GTGTCTGGGGAGAGAAAGTAGGG + Intronic
1128501994 15:68233170-68233192 GTGGCTGGGAAGGGGAAGTGAGG - Intronic
1128559596 15:68655917-68655939 GGGTGTGGGGAGTGGAACTAAGG + Intronic
1131121826 15:89827755-89827777 GTGTCCGGGCAGGGACACTGGGG + Intergenic
1134108785 16:11501794-11501816 CTGTCTGGGGAAGGGAACAATGG + Intronic
1135613801 16:23891977-23891999 GGGTGTGGGCAGGGGGCCTATGG - Intronic
1135913872 16:26586041-26586063 GTGTCTGGGCATGGGAAGCAAGG - Intergenic
1136368287 16:29819808-29819830 ATGTCTGGGCTGGGGAAGGAGGG - Exonic
1138588672 16:57987470-57987492 CTGTCTGGCCAGGGGACCTGAGG - Exonic
1138951299 16:61916562-61916584 GTGTCTGGCCTGGTGAACTCAGG + Intronic
1139327551 16:66164044-66164066 GAGTCTGGTCAGGGAAACTGAGG - Intergenic
1142225525 16:88875429-88875451 GTGGCTGGGCAGGAGCACCAGGG + Exonic
1142391043 16:89800231-89800253 GAATCTGGGCTGTGGAACTAAGG + Intronic
1143375460 17:6464379-6464401 GGGGCTGGGCGGGGGAACTCTGG + Intronic
1144750678 17:17646191-17646213 GGGGCTGGGCAGGGGAAATGGGG + Intergenic
1146009754 17:29184403-29184425 GTGTCGGGGCAGGGGGCATATGG + Intergenic
1149335071 17:55627153-55627175 GAGTCAGGGCAGTGGGACTAGGG + Intergenic
1149852546 17:60047841-60047863 ACCTCTGGGGAGGGGAACTAAGG + Intronic
1151047023 17:70932811-70932833 GTGTTTTGGCAGAGGAAATACGG + Intergenic
1151380928 17:73725348-73725370 GTGCTTGGGCAGGTGCACTAGGG + Intergenic
1152083963 17:78205927-78205949 GGGTCTGGGCAGGGGAGACATGG - Exonic
1153943276 18:9995311-9995333 GTGTCTCGCCAGAGAAACTAAGG + Intergenic
1154087353 18:11320442-11320464 GAGTGTGGGCAGGGGAATAATGG - Intergenic
1154200104 18:12293824-12293846 GGGTAGGGGCAGGGGAAGTAAGG - Intergenic
1158702633 18:59762403-59762425 GTGTTGGGGCAGGGGGAATATGG + Intergenic
1161352410 19:3801363-3801385 GTGACTGGGCCGGGGGACTCAGG + Intronic
1161483924 19:4524794-4524816 GTGTCTGGGGGGGGAAACTGAGG - Intronic
1161584238 19:5096512-5096534 GGGTCTGGGCAGGGGCACTGAGG - Intronic
1161703802 19:5808499-5808521 GTGTCTGGGGAGGGAGGCTAGGG - Intergenic
1162314169 19:9927427-9927449 GTTTCTGGAAATGGGAACTAGGG - Intronic
1162375014 19:10299781-10299803 GTCTCAGGGCAGGGGCACAACGG - Intergenic
1162723170 19:12674402-12674424 GGGCTTGGCCAGGGGAACTAAGG + Intronic
1162860895 19:13505523-13505545 TGGCCAGGGCAGGGGAACTATGG - Intronic
1162915182 19:13870923-13870945 CTTTCTGGGCAGGGGAGCTGGGG - Intronic
1163523291 19:17805052-17805074 CAGTCAGGGCAGGGCAACTAAGG - Intronic
1163627473 19:18398354-18398376 GTGTCTGGGGTGGGCAACTTGGG + Intergenic
1163783197 19:19261241-19261263 GTCTCTGGGGAGGGGAACGTGGG + Intronic
1164142739 19:22487516-22487538 GTCTCTGGGAAGGGGATCTCCGG + Intronic
1166190777 19:41175129-41175151 GACTCTGGGCAGGTGACCTAGGG + Intergenic
1166289859 19:41855904-41855926 GTGTGTTGGCAAGGGGACTATGG - Intergenic
1167442150 19:49514544-49514566 GGGTCCTGGCAGGGGAACTGAGG - Intronic
1167716663 19:51146641-51146663 GTTTCTGGGAAGGGGGATTAGGG + Intronic
1168493143 19:56827921-56827943 GCCTCTGGGGAAGGGAACTAGGG + Intronic
927392485 2:22610956-22610978 TTGTTTGGGCAGGGGAACTTGGG + Intergenic
927580091 2:24235569-24235591 GTGTCGGGGCAAGGGACATATGG + Intronic
928709152 2:33985222-33985244 GTGTATAGGCAGGGCAACTTGGG + Intergenic
928753806 2:34500353-34500375 GTGTCTGGGGAGGCAAAGTATGG + Intergenic
929479650 2:42292617-42292639 GTGACTGGAAAGGGGATCTAGGG + Intronic
929508800 2:42550635-42550657 GAGACTGGGAAGGGGAACTGGGG + Intronic
929607041 2:43241541-43241563 GTGTCTGGACAGGGGTGCAAAGG + Intronic
930655303 2:54001906-54001928 GTGTGGGGACAGGGGAAATATGG - Intronic
931158701 2:59664694-59664716 GTGTGTGTGTAGGGGAACCAGGG - Intergenic
931317792 2:61148936-61148958 GTGTCGGGGCAGGAGGTCTATGG + Intronic
931516671 2:63054220-63054242 GGGTCTGGGTAGGGGAGCTGAGG + Intronic
931738716 2:65222524-65222546 GAGTCTGGGAAGGGAAACTGGGG + Intergenic
931792692 2:65679029-65679051 GGGTCTGTGCAGTGGAACTAAGG - Intergenic
932488912 2:72106040-72106062 GTGTGGGGGCAGGGGTTCTATGG - Intergenic
933455003 2:82508716-82508738 GTGTCTGGGTAAGGGAAACAAGG - Intergenic
934734804 2:96684678-96684700 GTGACTGTGCAGTGCAACTAGGG + Intergenic
935948013 2:108303514-108303536 GTGTCAGGGCAGGTGAATAATGG + Intronic
937230806 2:120397097-120397119 GTTTCTGGGCCGGGAAAGTAGGG + Intergenic
938394415 2:130932058-130932080 GGGTCTGGGGAGGGGAAATGGGG - Intronic
940722563 2:157298265-157298287 GTCTAGGGGCAGGGGATCTAAGG + Intronic
941214198 2:162685190-162685212 CTGTTGGGGCTGGGGAACTAGGG + Intronic
941580270 2:167288520-167288542 GTGTCGGGGAAGGGGGAGTAAGG - Intergenic
941668383 2:168264033-168264055 GTGTCAGGGCAGGGGAGATATGG - Intergenic
942706905 2:178784188-178784210 GTGTCAGCGAAGGGGAACTGTGG + Exonic
946033400 2:216723095-216723117 GTGTGTGGGCAGGTGACCTGTGG - Intergenic
946671754 2:222112168-222112190 GTGTCAGGGCAGGGGACGTATGG + Intergenic
947531231 2:230909816-230909838 CTGTCTGGGCAGTGGAAAAAAGG + Exonic
947950157 2:234139845-234139867 GTGTGTGGGCATGGGAGCTCTGG + Intergenic
948579326 2:238973290-238973312 GTGTCTGGACAGGGTCACAAAGG - Intergenic
1168836570 20:881570-881592 GGGCATGGGGAGGGGAACTAAGG + Intronic
1169094996 20:2889750-2889772 GAGACTGGGAAAGGGAACTAAGG + Intronic
1171522696 20:25787655-25787677 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171530441 20:25849624-25849646 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171554131 20:26068228-26068250 CTGTCTGGTCAGAGGAACTTGGG - Intergenic
1172589331 20:36106151-36106173 GGGTGTGGGTGGGGGAACTAAGG + Intronic
1173836749 20:46130791-46130813 GTGGCGGGGAAGGGGAACTTTGG + Intergenic
1173869261 20:46331426-46331448 CTGTCTGGGCAGGGGGTCTGTGG + Intergenic
1174758884 20:53186875-53186897 GTGTGTGCGCAGGGACACTAGGG + Intronic
1174923116 20:54726183-54726205 ATGTCTAGGCAGGTAAACTAGGG - Intergenic
1175295078 20:57902874-57902896 GTGGCTGGGGAGGGGAAGAACGG + Intergenic
1175364219 20:58440367-58440389 GAATCTTGGCAGGGGAAATAAGG + Intronic
1175411388 20:58771982-58772004 ATCTTTGGGCAGGGGAGCTAGGG - Intergenic
1175989669 20:62781737-62781759 GGGTCTGGTCAGGGAACCTAAGG + Intergenic
1181312827 22:21954635-21954657 GTGTCTGGGCAGAGAAAGCAGGG + Intergenic
1181345934 22:22220707-22220729 GTGTCTGGGCAGAGAAAGCAGGG + Intergenic
1182817348 22:33177150-33177172 CTGTCGGGGCTGGGGGACTAGGG + Intronic
1183110983 22:35648492-35648514 GTGTCTGGGCTGGAGAAAGACGG - Exonic
1183269021 22:36849220-36849242 GTGTGGGGGCAGAGGAACAAGGG + Intergenic
950103284 3:10371548-10371570 GTGTGTGGGCAGGGGGAGTGGGG + Intronic
952446989 3:33390714-33390736 GTGTCAGGGCAGAGGACCTGAGG + Intronic
953815949 3:46156657-46156679 GTGTCAGGGCAGGGGTAGTATGG - Intergenic
954381193 3:50220207-50220229 GAGTCTGGGCAGGGCTGCTAGGG - Exonic
954451310 3:50573153-50573175 GTGTCAGGGCAGGGACAGTAGGG + Intronic
955148008 3:56339299-56339321 GTTTCTGAGGAGGTGAACTATGG + Intronic
957439024 3:80218042-80218064 ATGACTGGGCAGGGGAACATGGG + Intergenic
960438168 3:117653110-117653132 GTGTGTGGGCAGGGGGTGTATGG + Intergenic
961043462 3:123693457-123693479 GTGTCTGAGCTGGAGAACCACGG + Intronic
966830779 3:184006595-184006617 GTCTCTGGGTAGAGGAATTAAGG + Intronic
968500120 4:945993-946015 GTCTCAGGGCAGGGGAGCTATGG - Intronic
968849653 4:3070224-3070246 CTCTCTGGGCAGGGGAATTGAGG - Intergenic
969443326 4:7229862-7229884 GTGTCTGGGCAGGAGCAGTGTGG + Intronic
969443405 4:7230808-7230830 GTGTCTGGGCAGGAGCAGTGTGG + Intronic
969479118 4:7437789-7437811 GTGTCTGGGCAAAGGTACTCGGG - Intronic
969628881 4:8323794-8323816 GTGTCTGGGAAGGGGCATTTTGG - Intergenic
970173281 4:13310256-13310278 GTCTCTGTGCAGGGGAGGTAGGG + Intergenic
971195831 4:24471281-24471303 GTGTCTGGGCTGGGGAAAGTTGG - Intergenic
971293121 4:25362914-25362936 GTGTCGGGGCAGGGGACATAGGG - Intronic
973272571 4:48276543-48276565 CTGTCTTGGCAGGGGAAGGAGGG - Intergenic
975082394 4:70296828-70296850 GTGTCCTGGCAGGGGAGCTTTGG - Intergenic
976280627 4:83323412-83323434 GTGTGTGGGCAGGGGGTTTATGG + Intronic
980800704 4:137746019-137746041 GTGTGAGGGCAGGGGATTTAGGG - Intergenic
984587840 4:181583060-181583082 GTCCCTGGGCAGTGGGACTAGGG + Intergenic
984605265 4:181778635-181778657 ATGTCTGAGCAGGGGAAGAAAGG - Intergenic
985192052 4:187385000-187385022 GTGTGAGAGCAGGGGAAATATGG + Intergenic
985922090 5:2985440-2985462 GGGTCTGGGCAGTGGAAGGAAGG - Intergenic
988007564 5:25436743-25436765 GTGTGAGGGCAGGGGATATATGG + Intergenic
989204346 5:38796724-38796746 GTGGCTGGGCAGGAGAATGAGGG - Intergenic
990926875 5:61036154-61036176 GGGTCTGGCCAGTGGAACAAGGG - Intronic
990941191 5:61204822-61204844 GTGACTGGGGAGGAGAAATATGG - Intergenic
991137077 5:63194305-63194327 CTGACTTGGCAGGGGAGCTATGG + Intergenic
993527450 5:88983938-88983960 GTGCCTGGGGATGGGAAGTAGGG - Intergenic
993603623 5:89959485-89959507 GTGTGGGGGTAGGGGAAATATGG - Intergenic
994220123 5:97185814-97185836 GGGTCAGGGCAGGGGAGGTAAGG - Intergenic
998230966 5:140361174-140361196 GTGTCTGGGCAGAGGGAGAAGGG + Intronic
1002084504 5:176764184-176764206 GTGTATGGGCAGGGGGTATATGG - Intergenic
1002639907 5:180625830-180625852 GTGGCTGTGCAGGGGACCTGAGG + Intronic
1003455545 6:6278517-6278539 GTATCTGAGCAGGGGAATTGGGG + Intronic
1003455587 6:6278712-6278734 GTGCCTGAGCAGGGGAATTGTGG + Intronic
1003980097 6:11381249-11381271 GCTTCTGGGCAGGGGAAGGAGGG + Intronic
1005018208 6:21393580-21393602 GTGCCTGGGGCGGGGAGCTAGGG - Intergenic
1005953459 6:30647660-30647682 TGGTCTGGGCCGGGGAACTCCGG - Exonic
1006586520 6:35118295-35118317 GTGCCTGGGCTGGGGAAATGAGG + Exonic
1007243032 6:40440771-40440793 GTGACTGGGCAGGGCAACTGAGG - Intronic
1007593224 6:43036000-43036022 GTGTCTTGGCAGGGCTACTGGGG - Intergenic
1009905558 6:69866967-69866989 GTGTCTGTGAAGCGGAACTATGG + Intronic
1011511018 6:88100952-88100974 GGGTCGGGGCAGGGAACCTAAGG - Intergenic
1012729362 6:102861596-102861618 GTGTCGGGGCAGGGGCTATATGG + Intergenic
1013621097 6:111889925-111889947 ATGTCTGGGGAGGGGTCCTAGGG + Intergenic
1015067821 6:129052531-129052553 GTGTTGGGGCGGGGGAAATATGG - Intronic
1015516087 6:134083821-134083843 GTATCAGGGCAAGGGAACAAGGG + Intergenic
1016813499 6:148282855-148282877 GAGTTTGGGGAGGGGGACTAGGG - Intronic
1017901600 6:158722704-158722726 ATCTCTGGGGAGGGGAACTGAGG + Intronic
1019307746 7:343944-343966 GTGACTGGGCAGGGGAGGGAAGG + Intergenic
1019998009 7:4737642-4737664 GGGTCCAGGCAGGGGACCTAAGG - Intronic
1026849007 7:73713327-73713349 GTGTCTGGGCTGGGAAACAGAGG - Intronic
1031902061 7:127421758-127421780 ATCTCTGAGCAGGGGAATTATGG + Intronic
1032499704 7:132391261-132391283 GTCTCAGGGCAGGAGAACTGGGG + Intronic
1034609218 7:152349877-152349899 GTGTCGGGGAAGGGGATTTATGG + Intronic
1037856989 8:22378901-22378923 GTATCTTGTCAGGGGAACCATGG - Intronic
1039333370 8:36563261-36563283 GTGTTGGGGCAGGGGATATATGG + Intergenic
1040724411 8:50364200-50364222 GTGGCTTGCCAGGGGAACTATGG - Intronic
1040935398 8:52777056-52777078 GTGTCTGGGCAAAGGACATATGG - Intergenic
1041525149 8:58796990-58797012 GTCTGTGGTCAGTGGAACTATGG + Intergenic
1041688546 8:60667171-60667193 GTCTTTGGGCATGGGATCTAAGG - Intergenic
1043414409 8:80033132-80033154 GTGTCTGGGCAAGGGAAACGTGG + Intronic
1043532158 8:81163053-81163075 GTCTCAGGGCAGGGGACATATGG - Intergenic
1043989747 8:86738411-86738433 GTGTTTGGGCTGGGTAACAAGGG + Intronic
1044848116 8:96401491-96401513 GTGTGGGGGCAGGGGATATATGG + Intergenic
1045113076 8:98951728-98951750 GTGTCTGGGGAGGGGAGCAGCGG - Exonic
1045372940 8:101543258-101543280 GTCACTGGGCATGGGCACTAAGG - Exonic
1046839378 8:118840498-118840520 GTCTCTGGGCAGGGGAAAAATGG - Intergenic
1047296047 8:123571298-123571320 GTGTGGGGGCAGGCCAACTAGGG - Intergenic
1047463650 8:125091903-125091925 GGGTCTAGGCAGGGGAAATTGGG + Exonic
1048270025 8:133021022-133021044 GTGTCTGAGCTGGGGATCTGAGG - Intronic
1048340856 8:133537422-133537444 GTGTTAGGGCAGGGGAAGGAAGG + Intronic
1048969739 8:139638797-139638819 GTGTTTGGGCCGGGGAACCTGGG - Intronic
1049036949 8:140084176-140084198 GAGGCTGGGCAGTGGAACCATGG + Intronic
1049248851 8:141577516-141577538 GTATCTTGGCAGGGAAACAATGG - Intergenic
1049404266 8:142444668-142444690 GCCTCTGGGCAGAGGAACTAGGG + Intergenic
1050433839 9:5588726-5588748 GGGTCTGGGAAGGGGAGCCATGG + Intergenic
1051166152 9:14264298-14264320 TTGACTGGGCAGGTGAAGTAAGG - Intronic
1053237696 9:36470368-36470390 GTTTCTGGGAATGGGAAGTAGGG + Intronic
1058895549 9:109397687-109397709 GTGCCTGGAAAGGGGCACTATGG - Intronic
1060492550 9:124095599-124095621 GTGACTGGGAAGGGGACATACGG - Intergenic
1060664108 9:125422749-125422771 GACTTTGGGCAGGGGAAGTATGG + Intergenic
1060720060 9:125970648-125970670 TTGTCTGGCCAGGAGAGCTAAGG - Intergenic
1061299672 9:129697438-129697460 GTGTCTGGGCCGCGGGACTGCGG + Intronic
1061873490 9:133532801-133532823 GTGGCTGGCCAGGGGAGCTGGGG + Intronic
1062068915 9:134544760-134544782 CTGTCAGGGGAGGGGAACCAGGG - Intergenic
1187006604 X:15239073-15239095 GTGTTTGGACTGGGGAACTAAGG - Intronic
1187181830 X:16949782-16949804 GTGTCGGGGCAGGGGATATATGG - Intronic
1189601995 X:42636652-42636674 GTGTATGGGGATGGGAACTGAGG + Intergenic
1189854015 X:45205097-45205119 GTGTCGGGGGAGGGGAAGTGGGG - Intergenic
1192555218 X:72083915-72083937 GTGTGTGGGCAGGGGGAGTAAGG - Intergenic
1196336442 X:114541912-114541934 TTGTCTGGGAAGGGGAATGAGGG + Intergenic
1198194155 X:134343163-134343185 GTGTGGGGGCAGGGGATATATGG - Intergenic
1201965318 Y:19726549-19726571 CTGTCAGGGCTGGGGGACTAGGG + Intronic