ID: 1072898540

View in Genome Browser
Species Human (GRCh38)
Location 10:99387896-99387918
Sequence AGTGGAGTCCCCGTCTGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072898540_1072898552 17 Left 1072898540 10:99387896-99387918 CCTTCACAGACGGGGACTCCACT 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1072898552 10:99387936-99387958 GGGCACACCCCAGACCCCTAAGG 0: 1
1: 0
2: 0
3: 13
4: 149
1072898540_1072898544 -4 Left 1072898540 10:99387896-99387918 CCTTCACAGACGGGGACTCCACT 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1072898544 10:99387915-99387937 CACTAAGGCCCCCACAACCCGGG 0: 1
1: 0
2: 2
3: 16
4: 164
1072898540_1072898545 -3 Left 1072898540 10:99387896-99387918 CCTTCACAGACGGGGACTCCACT 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1072898545 10:99387916-99387938 ACTAAGGCCCCCACAACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 69
1072898540_1072898543 -5 Left 1072898540 10:99387896-99387918 CCTTCACAGACGGGGACTCCACT 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1072898543 10:99387914-99387936 CCACTAAGGCCCCCACAACCCGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072898540 Original CRISPR AGTGGAGTCCCCGTCTGTGA AGG (reversed) Exonic
906540734 1:46583820-46583842 AGTGGAGACAGCCTCTGTGAAGG + Intronic
910658577 1:89644515-89644537 AGTGGAGTCTCTTTCTGTCAAGG - Intronic
1067582836 10:47456319-47456341 AGAGGAGTCCCCGGGTGTGCTGG + Intergenic
1071276741 10:84062311-84062333 AGCAGAGTCCCCTTCAGTGATGG - Intergenic
1072898540 10:99387896-99387918 AGTGGAGTCCCCGTCTGTGAAGG - Exonic
1074143794 10:110699118-110699140 AGTGGAGCCCCCGTCTAACATGG - Intronic
1074714897 10:116209375-116209397 AGTGGAGTCCCTGCCTGTTTGGG - Intronic
1074894570 10:117763829-117763851 AGTGGAGACCCAGTCTCTGCTGG + Intergenic
1075310608 10:121410601-121410623 AGTTGAGCACCCGTCTATGATGG - Intergenic
1079324293 11:19478293-19478315 AGGGGAGTCCCAGTCACTGAGGG + Intronic
1079380654 11:19934333-19934355 AGTGGATTCCGGGTCTGTAAGGG + Intronic
1083195516 11:61083528-61083550 ATTTGAGTCTCCCTCTGTGAAGG - Intergenic
1084379945 11:68805480-68805502 AGTGGAGTCCCGGTGTGTGGTGG + Intronic
1085294383 11:75422740-75422762 TGTGGAGTCACTGTGTGTGACGG - Exonic
1087554810 11:99704210-99704232 GGTGGATTCCCAGTCTGGGATGG - Intronic
1089219749 11:116860754-116860776 AGTGTAGTCCCCATGTGTCAAGG + Intronic
1089677802 11:120101983-120102005 AGTGAGGTCCCCATCAGTGAAGG - Intergenic
1093967753 12:25345249-25345271 AGTGGTCTCCCGGTCTCTGATGG - Intergenic
1101226140 12:102689914-102689936 AGTGGATTCACCCACTGTGACGG - Intergenic
1102001439 12:109560235-109560257 ATTGGAGTCCACGTCTGTCTGGG - Intronic
1105913454 13:24891970-24891992 AGTGGCGTCGCCGTCTGGGTGGG - Intronic
1109418210 13:62072359-62072381 AGGGGAGTCTCCGTCTGTAAAGG - Intergenic
1123974091 15:25536179-25536201 AATTGAGTTCCCGTCCGTGAGGG - Intergenic
1134185228 16:12079758-12079780 GGAGGAGTCCCGGTCTCTGATGG - Intronic
1142275703 16:89117793-89117815 AGAGGAGTCCCCGGCTGAGGAGG + Intronic
1147391912 17:40114564-40114586 AGTGGAGTTGCCAGCTGTGAGGG - Intergenic
1149237810 17:54613124-54613146 AGTGGAGTCTGGGTCTGTGTGGG - Intergenic
1151681446 17:75624838-75624860 AGTGGAGCCGCCGGCTGTGCAGG - Intergenic
1152281176 17:79385657-79385679 ACTGGAGCCCCTGTCTGTAACGG - Intronic
1153788986 18:8560725-8560747 AGTGTATTCACCGTCTGTCATGG - Intergenic
1155663618 18:28281530-28281552 AGTGAAGCCCCAGTCTATGAAGG + Intergenic
1160440147 18:78883558-78883580 AGTGGAACCCCCATATGTGAAGG + Intergenic
1161248347 19:3267469-3267491 AGTGGTGTCCGGGGCTGTGACGG - Intronic
1161373447 19:3926742-3926764 TGTGGAGCCACCGGCTGTGACGG + Exonic
1162638892 19:11991577-11991599 AATGGAGTTCCCCGCTGTGACGG - Intergenic
1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG + Intronic
926205210 2:10830777-10830799 GGTGGAGTCCCCGTGTGTCCAGG - Intronic
936736035 2:115444949-115444971 AGTGTAATCCCCGTGTGTCAAGG + Intronic
938383173 2:130847989-130848011 AGTGGAGGCCACGGGTGTGAGGG + Intronic
945257457 2:207814150-207814172 AGGGGAGTCACTGTGTGTGAAGG - Intergenic
947178143 2:227388070-227388092 GGTGGAGACCTCCTCTGTGAAGG - Intergenic
947582862 2:231332509-231332531 TGTGGAGTCACCATCTGGGATGG + Intronic
1170302864 20:14905596-14905618 AGTGGTCTCCCAGACTGTGAGGG - Intronic
1170779981 20:19416511-19416533 ACTGGTGTCCTTGTCTGTGAGGG - Intronic
1174405497 20:50300320-50300342 ACCTGAGTCCCCTTCTGTGAAGG + Intergenic
1178673360 21:34611910-34611932 AAGGGAGTCCCAGTCTCTGAGGG - Intronic
1184929773 22:47672474-47672496 AGTTGAGTCCAAGTCTGTAATGG + Intergenic
959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG + Intronic
964651578 3:159016947-159016969 AGTGGGGTCTCGGTCTGTGATGG + Intronic
967743782 3:193031966-193031988 GCTGCAGTCCCCGTCTGTCAGGG + Intergenic
968312169 3:197693139-197693161 AGTGGGGTTCCAGTCTGGGAAGG - Intronic
981026316 4:140080303-140080325 AGTAGAGCTCCTGTCTGTGATGG - Intronic
983617550 4:169724840-169724862 AGTGGAATACCCTTCTTTGAAGG - Intergenic
985605752 5:857319-857341 GATGGAGTCCCAGTCTGAGAAGG - Intronic
988474063 5:31567075-31567097 AGAGGAGCCCCCTTCTGTGGTGG - Intergenic
994263243 5:97684629-97684651 AGAGGAGTACCCGGCTGTGTGGG + Intergenic
998430613 5:142066569-142066591 AGTGGAGGTGCCATCTGTGAAGG + Intergenic
1006257938 6:32845804-32845826 AGGGTAGTCCCCGGCTCTGACGG - Intronic
1011131257 6:84053909-84053931 TGTGGAGTCCATGTCTGGGATGG + Intronic
1011338097 6:86283504-86283526 AGAGGAGTACCCGGCTGTGTGGG + Intergenic
1020396229 7:7721744-7721766 ACTGAACTCCCCATCTGTGATGG + Intronic
1020637882 7:10718224-10718246 AGTTGAGTCCCTTTGTGTGAAGG - Intergenic
1022198111 7:28089218-28089240 AGTGGAGTCCTTGCCTATGATGG + Intronic
1026878148 7:73891519-73891541 AGGGGACTCCCAGTCTGGGATGG + Intergenic
1034254021 7:149714778-149714800 AGTGTAGTCCGCGTCTGCGCCGG + Intronic
1034928588 7:155142772-155142794 AAAGGAGTCCCCGACTTTGAGGG - Intergenic
1035617600 8:1013618-1013640 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617617 8:1013745-1013767 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617622 8:1013778-1013800 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617627 8:1013811-1013833 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617652 8:1014002-1014024 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617657 8:1014033-1014055 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617674 8:1014163-1014185 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617679 8:1014196-1014218 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617684 8:1014229-1014251 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617697 8:1014326-1014348 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617714 8:1014453-1014475 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617739 8:1014642-1014664 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617744 8:1014675-1014697 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617749 8:1014708-1014730 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617774 8:1014899-1014921 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617779 8:1014930-1014952 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617792 8:1015024-1015046 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617797 8:1015057-1015079 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617818 8:1015217-1015239 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617827 8:1015283-1015305 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617844 8:1015411-1015433 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617865 8:1015570-1015592 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617918 8:1015987-1016009 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617935 8:1016115-1016137 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035617944 8:1016181-1016203 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617953 8:1016245-1016267 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617963 8:1016311-1016333 AGTGGAGGCGCCGTCTGTCCCGG - Intergenic
1035617984 8:1016472-1016494 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035617993 8:1016536-1016558 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035618006 8:1016633-1016655 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035618027 8:1016794-1016816 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035618040 8:1016891-1016913 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035618053 8:1016988-1017010 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035618058 8:1017021-1017043 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035618067 8:1017085-1017107 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035618077 8:1017151-1017173 AGTGGAGGCGCCGTCTGTCCCGG - Intergenic
1035618098 8:1017312-1017334 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035618111 8:1017409-1017431 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035618116 8:1017442-1017464 AGTGGAGGCACCGTCTGTCCTGG - Intergenic
1035618121 8:1017475-1017497 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1035618138 8:1017600-1017622 AGTGGAGGCGCCGTCTGTCCTGG - Intergenic
1037334981 8:17783240-17783262 AGTGAAGTCTCTGGCTGTGAAGG + Intronic
1038871861 8:31503902-31503924 AGTGGAGTCCACTGCTCTGAAGG - Intergenic
1039567869 8:38564251-38564273 AGTGGCGACCTTGTCTGTGAGGG + Intergenic
1050147607 9:2585743-2585765 ATTGAAGTCCCCCACTGTGATGG - Intergenic
1054605239 9:67170375-67170397 TGTGGATTCCCTGTCTTTGAGGG - Intergenic
1057464029 9:95294818-95294840 AGTGGAGTCCATGTGTGAGACGG + Intronic
1061364418 9:130164189-130164211 AGGGGAGTAGACGTCTGTGAGGG + Intergenic
1190311874 X:49122634-49122656 GGTGGTGTCCCAGGCTGTGAAGG - Exonic
1191984072 X:66959709-66959731 AGAGGAGCCCACCTCTGTGAAGG - Intergenic
1198079702 X:133227858-133227880 AGTGGATTCCTCTTCTATGAGGG - Intergenic