ID: 1072913852

View in Genome Browser
Species Human (GRCh38)
Location 10:99525155-99525177
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072913852_1072913861 22 Left 1072913852 10:99525155-99525177 CCTCATCTATGGACTCTCCTTGC No data
Right 1072913861 10:99525200-99525222 ACCTTTGCACATGAATGCTCAGG No data
1072913852_1072913859 -3 Left 1072913852 10:99525155-99525177 CCTCATCTATGGACTCTCCTTGC No data
Right 1072913859 10:99525175-99525197 TGCAGAGGAGGGTGTCACCGGGG No data
1072913852_1072913858 -4 Left 1072913852 10:99525155-99525177 CCTCATCTATGGACTCTCCTTGC No data
Right 1072913858 10:99525174-99525196 TTGCAGAGGAGGGTGTCACCGGG No data
1072913852_1072913857 -5 Left 1072913852 10:99525155-99525177 CCTCATCTATGGACTCTCCTTGC No data
Right 1072913857 10:99525173-99525195 CTTGCAGAGGAGGGTGTCACCGG No data
1072913852_1072913863 25 Left 1072913852 10:99525155-99525177 CCTCATCTATGGACTCTCCTTGC No data
Right 1072913863 10:99525203-99525225 TTTGCACATGAATGCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072913852 Original CRISPR GCAAGGAGAGTCCATAGATG AGG (reversed) Intergenic