ID: 1072913856

View in Genome Browser
Species Human (GRCh38)
Location 10:99525172-99525194
Sequence CGGTGACACCCTCCTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072913856_1072913861 5 Left 1072913856 10:99525172-99525194 CCTTGCAGAGGAGGGTGTCACCG No data
Right 1072913861 10:99525200-99525222 ACCTTTGCACATGAATGCTCAGG No data
1072913856_1072913863 8 Left 1072913856 10:99525172-99525194 CCTTGCAGAGGAGGGTGTCACCG No data
Right 1072913863 10:99525203-99525225 TTTGCACATGAATGCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072913856 Original CRISPR CGGTGACACCCTCCTCTGCA AGG (reversed) Intergenic