ID: 1072913858

View in Genome Browser
Species Human (GRCh38)
Location 10:99525174-99525196
Sequence TTGCAGAGGAGGGTGTCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072913849_1072913858 9 Left 1072913849 10:99525142-99525164 CCAAACTCAACCTCCTCATCTAT No data
Right 1072913858 10:99525174-99525196 TTGCAGAGGAGGGTGTCACCGGG No data
1072913848_1072913858 10 Left 1072913848 10:99525141-99525163 CCCAAACTCAACCTCCTCATCTA No data
Right 1072913858 10:99525174-99525196 TTGCAGAGGAGGGTGTCACCGGG No data
1072913847_1072913858 14 Left 1072913847 10:99525137-99525159 CCATCCCAAACTCAACCTCCTCA No data
Right 1072913858 10:99525174-99525196 TTGCAGAGGAGGGTGTCACCGGG No data
1072913851_1072913858 -1 Left 1072913851 10:99525152-99525174 CCTCCTCATCTATGGACTCTCCT No data
Right 1072913858 10:99525174-99525196 TTGCAGAGGAGGGTGTCACCGGG No data
1072913852_1072913858 -4 Left 1072913852 10:99525155-99525177 CCTCATCTATGGACTCTCCTTGC No data
Right 1072913858 10:99525174-99525196 TTGCAGAGGAGGGTGTCACCGGG No data
1072913845_1072913858 16 Left 1072913845 10:99525135-99525157 CCCCATCCCAAACTCAACCTCCT No data
Right 1072913858 10:99525174-99525196 TTGCAGAGGAGGGTGTCACCGGG No data
1072913844_1072913858 22 Left 1072913844 10:99525129-99525151 CCTGGGCCCCATCCCAAACTCAA No data
Right 1072913858 10:99525174-99525196 TTGCAGAGGAGGGTGTCACCGGG No data
1072913843_1072913858 23 Left 1072913843 10:99525128-99525150 CCCTGGGCCCCATCCCAAACTCA No data
Right 1072913858 10:99525174-99525196 TTGCAGAGGAGGGTGTCACCGGG No data
1072913846_1072913858 15 Left 1072913846 10:99525136-99525158 CCCATCCCAAACTCAACCTCCTC No data
Right 1072913858 10:99525174-99525196 TTGCAGAGGAGGGTGTCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072913858 Original CRISPR TTGCAGAGGAGGGTGTCACC GGG Intergenic