ID: 1072913861

View in Genome Browser
Species Human (GRCh38)
Location 10:99525200-99525222
Sequence ACCTTTGCACATGAATGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072913856_1072913861 5 Left 1072913856 10:99525172-99525194 CCTTGCAGAGGAGGGTGTCACCG No data
Right 1072913861 10:99525200-99525222 ACCTTTGCACATGAATGCTCAGG No data
1072913851_1072913861 25 Left 1072913851 10:99525152-99525174 CCTCCTCATCTATGGACTCTCCT No data
Right 1072913861 10:99525200-99525222 ACCTTTGCACATGAATGCTCAGG No data
1072913852_1072913861 22 Left 1072913852 10:99525155-99525177 CCTCATCTATGGACTCTCCTTGC No data
Right 1072913861 10:99525200-99525222 ACCTTTGCACATGAATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072913861 Original CRISPR ACCTTTGCACATGAATGCTC AGG Intergenic