ID: 1072915641

View in Genome Browser
Species Human (GRCh38)
Location 10:99535938-99535960
Sequence CAGAAACGCCGGCTGGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072915637_1072915641 -5 Left 1072915637 10:99535920-99535942 CCAGGACTGTCTCTGAGGCAGAA 0: 1
1: 0
2: 0
3: 9
4: 222
Right 1072915641 10:99535938-99535960 CAGAAACGCCGGCTGGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1072915635_1072915641 2 Left 1072915635 10:99535913-99535935 CCGGTCGCCAGGACTGTCTCTGA 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1072915641 10:99535938-99535960 CAGAAACGCCGGCTGGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072915641 Original CRISPR CAGAAACGCCGGCTGGGCGC CGG Exonic
901628910 1:10638833-10638855 CGGAAGCACCGGCGGGGCGCGGG + Exonic
903265781 1:22157135-22157157 CAGACACCCTGGCTGGGCCCGGG - Intergenic
904047166 1:27615712-27615734 CTGGAGCGCCGGCTGGGCACCGG - Exonic
904813895 1:33181505-33181527 CAGCACCGAGGGCTGGGCGCGGG + Exonic
906140702 1:43531857-43531879 CAGAGACGCCGGCACGGCGATGG - Intronic
907567775 1:55452321-55452343 GAGAGACACCGGCTGGGCGCAGG - Intergenic
916714375 1:167437051-167437073 CAATAACCACGGCTGGGCGCGGG + Intronic
920924458 1:210328797-210328819 CAGAAACGCAGGCCGCGCTCTGG + Intronic
923126639 1:231039810-231039832 CCGAAAGGGCGGGTGGGCGCGGG + Intronic
923351222 1:233108776-233108798 CAGGAACACCTGCTGGGCCCAGG + Intronic
923438766 1:233995415-233995437 CAGAAACGCCAGCCAGGCTCAGG - Intronic
923863943 1:237919082-237919104 AAGAAACGGCAGCTGGGCCCGGG + Intergenic
924443013 1:244102582-244102604 CAGAAAAGCCGGCTGGGTCCTGG + Intergenic
1065342831 10:24723207-24723229 CGGAGACGCTGGCCGGGCGCCGG + Intronic
1065573905 10:27099920-27099942 CAGAAAGGCGGCCTGGGCGCTGG + Intronic
1067052002 10:43026926-43026948 GAGGAAAGCCAGCTGGGCGCGGG + Intergenic
1072863231 10:99029392-99029414 AAGAAAAGCCAGCTGGGCCCGGG + Intronic
1072915641 10:99535938-99535960 CAGAAACGCCGGCTGGGCGCCGG + Exonic
1073435405 10:103513096-103513118 CAGCAAAGCCGGGTGGGCACCGG - Intronic
1075745625 10:124725328-124725350 CAGCAGCCCCGGCTGGGCTCAGG + Intronic
1076347917 10:129793364-129793386 CAGAAAGGCCTACTGGGTGCCGG - Intergenic
1078180264 11:9004650-9004672 CGGAAACGCGGGCCGGGTGCCGG - Intergenic
1083118957 11:60491838-60491860 CAGAAGGGGCGGCTGGGCGGAGG - Intergenic
1083332970 11:61907545-61907567 GAGGTACACCGGCTGGGCGCGGG - Exonic
1084972993 11:72781595-72781617 CAGCGACGCCGGGCGGGCGCGGG + Intronic
1090805018 11:130197538-130197560 CAGAGAGGCCAGCTGGTCGCAGG - Intronic
1092272842 12:7037219-7037241 CAGAAGCCTCGGCAGGGCGCTGG - Intronic
1096099027 12:48957597-48957619 CAGCACCGGCGGCCGGGCGCTGG + Intergenic
1102309721 12:111835667-111835689 CAGGAACCCGGGCTGCGCGCGGG + Intergenic
1104036738 12:125102807-125102829 CAGCCATGCCGGCTGGGAGCCGG - Intronic
1104253513 12:127119611-127119633 CAGAAAAGCTGGCTTGGAGCTGG - Intergenic
1104435868 12:128756115-128756137 CAGAAAAACAGGCTGGGTGCGGG + Intergenic
1104960736 12:132487567-132487589 CAGAGACGGCGGCTGGTCCCTGG + Intergenic
1105558263 13:21466109-21466131 GAGAAACGCAGGCTTGGGGCAGG - Intergenic
1105659161 13:22473967-22473989 CAGAAGCTCCAGCTGGGCTCAGG - Intergenic
1106489073 13:30200419-30200441 CAGAAAGGCAGGGTGGGCTCAGG - Intergenic
1107340993 13:39405617-39405639 CAGAAACCCAGACTGGGGGCAGG + Intronic
1108615639 13:52129125-52129147 AGGAAACGCGGGCGGGGCGCGGG + Intergenic
1128064111 15:64753888-64753910 CAGAGAGGCCTGCTGGGCTCAGG - Intronic
1128547720 15:68579136-68579158 CCGAGCCGCCGGCGGGGCGCGGG + Exonic
1128622444 15:69161424-69161446 CAGAAACCCCGGCCAGACGCTGG - Intronic
1129011504 15:72422370-72422392 AAGAAATGGTGGCTGGGCGCAGG + Intergenic
1131220973 15:90583767-90583789 CAGAGAGGCTGGCTGGGTGCTGG + Intronic
1131231904 15:90665640-90665662 CAGAAACGCAGGCTGAACGCTGG - Intergenic
1132333433 15:101027892-101027914 CAGAAACGCAGGCTGGGTGTCGG - Intronic
1132739010 16:1401654-1401676 CAGAACGGCCAGCTGGGCGGCGG - Exonic
1134438791 16:14285433-14285455 CAGCAACCCTGGCTGGGCGTGGG + Intergenic
1138490391 16:57372962-57372984 CAGAAGCTCCTGCTGGGCACTGG + Intronic
1140376276 16:74447847-74447869 CAGAAAGCCCTGCTGGGCTCTGG + Intergenic
1142032915 16:87847315-87847337 CAGAAACATCGTCTGGGGGCTGG + Intronic
1143487166 17:7261466-7261488 CAGAAACGGCCCCGGGGCGCGGG - Intronic
1148836569 17:50468844-50468866 CAGCAGCGGCGGCGGGGCGCGGG + Exonic
1153911274 18:9708329-9708351 GAGAGACGCCGGCGGGGCGCGGG + Exonic
1154025553 18:10704419-10704441 CAGAACCGGCGGCTGGGCCTGGG + Exonic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1160892529 19:1386904-1386926 CAGAAAGGCAGGCTTGGTGCTGG - Intronic
1161021419 19:2013382-2013404 CAGAAAGGAGGGCTGGGGGCTGG + Intronic
1167619054 19:50551248-50551270 CAGAGACCCCGGCTGGCCGGAGG - Intronic
929541635 2:42827738-42827760 CAGAAACGGCGGCTCAGAGCGGG - Intergenic
930768955 2:55112857-55112879 CAGAAACTCCAGCTGGGGGTTGG - Intergenic
931426801 2:62178871-62178893 CAGAAAGGCCAGCTTGGCTCTGG - Intergenic
940561570 2:155303989-155304011 CACAAACGACGGATGGGAGCTGG - Intergenic
941285649 2:163609764-163609786 CAGAAAAGCCTTCTGTGCGCTGG + Exonic
946392552 2:219425476-219425498 CAGAACCACCTGCTGGGTGCTGG + Intronic
949022690 2:241750366-241750388 CAGAGACCCCGGGTGGGCGGGGG + Intronic
1172484495 20:35290270-35290292 AAGAAAGGCCAGCTGGGGGCTGG - Intronic
1173534494 20:43799227-43799249 CATAAACGCTGGGTGGGGGCGGG - Intergenic
1174453076 20:50631517-50631539 CAGAGAGGCCGGCAGGGCTCAGG + Intronic
1174555735 20:51394198-51394220 CAGAAATGCCGGCTAGGTGGTGG + Intronic
1174800109 20:53556414-53556436 GTGAAACCCTGGCTGGGCGCGGG - Intergenic
1175081151 20:56421398-56421420 TAGAAACACAGGCTGGGGGCTGG + Intronic
1175908004 20:62391319-62391341 CAGAACCGCAAGCTGTGCGCTGG - Exonic
1175913561 20:62415641-62415663 CAGAAAAGCCAGCAGGGCACAGG - Exonic
1176051692 20:63123242-63123264 CAGAAACCACGGCTGTGCTCAGG - Intergenic
1179585123 21:42369976-42369998 CAGGGAGGTCGGCTGGGCGCAGG - Intergenic
1183618969 22:38961772-38961794 CAGAAACGATGGCTGGACTCTGG + Intronic
1183624172 22:38991717-38991739 CAGAAACGATGGCTGGACTCTGG + Intronic
1184128253 22:42502311-42502333 CAGAAGGTCCGGCTGGGCACAGG - Intergenic
1184137043 22:42555624-42555646 CAGAAGGTCCGGCTGGGCACAGG - Intronic
1184391181 22:44204563-44204585 CAGAAACGCCAGCCTGGCCCAGG - Intronic
1184672482 22:46022363-46022385 TATAAATGCAGGCTGGGCGCGGG + Intergenic
1184769868 22:46590600-46590622 GAGAAACCCGGGCTGGGCCCAGG + Intronic
1185229356 22:49671199-49671221 CCGAAACGCTGCCTGGACGCTGG - Intergenic
953920466 3:46948009-46948031 CAGAAAAGCCAGCGGGGCACAGG + Intronic
954103898 3:48398819-48398841 CAGCAACCTGGGCTGGGCGCAGG + Intronic
955062620 3:55506259-55506281 CAGAAGAGCCTGCTGGGCACTGG + Intergenic
959706402 3:109342259-109342281 CAGTAACACAGGCTGGGCGTTGG + Intergenic
961412735 3:126734463-126734485 CAGACATGCTGGCTGGGCACAGG + Intronic
968372788 4:11167-11189 GAAAAACGCCGGCGCGGCGCCGG + Intergenic
977560474 4:98528142-98528164 CAGAAAAGCCAGCTGTGCACAGG + Intronic
979396797 4:120198413-120198435 CAGAAATGCTGTCTGGGAGCTGG - Intergenic
979674471 4:123397451-123397473 CTGACACGCCGACTGTGCGCCGG + Intronic
984771605 4:183441470-183441492 CAGAAAAGCCAGCTTGCCGCTGG + Intergenic
985462606 4:190121399-190121421 GAAAAACGCCGGCGCGGCGCCGG - Intergenic
985819680 5:2151126-2151148 CAGAAACTCCCGCTGGACTCGGG + Intergenic
995048166 5:107672455-107672477 CAGCAGCGCTGGCTGGGCGCGGG - Intergenic
996304693 5:122033746-122033768 CAGAAGCACCGGCTGGGCGTGGG - Intronic
997202326 5:132018437-132018459 CAGAAAGGCCAGCAGGGCGGGGG + Intergenic
997676974 5:135720333-135720355 CAGAAGCACTGGCTGGGCCCAGG + Intergenic
1002523223 5:179802675-179802697 CAGAACCTCCAGCTGGGCCCAGG + Exonic
1010791561 6:80070633-80070655 CAGGGACGCTGGCCGGGCGCCGG + Intergenic
1011734232 6:90296308-90296330 CATAAAAGCGGGCAGGGCGCGGG + Intronic
1016590194 6:145735436-145735458 CAGCAGCTCCGGCCGGGCGCCGG + Exonic
1019276679 7:179560-179582 CTGCAACGCCGGCTGTGGGCTGG + Intergenic
1019416418 7:929002-929024 GAGGAATGCCGGCCGGGCGCGGG + Intronic
1019920242 7:4158561-4158583 CAGGAACGCGGTCTGGGCCCCGG - Intronic
1020029342 7:4921759-4921781 CCGACACCCAGGCTGGGCGCCGG + Intronic
1023881834 7:44325240-44325262 CAGAGAAGCCGGCGGCGCGCGGG + Intronic
1026858385 7:73769565-73769587 CAGAAGCGCGAGATGGGCGCGGG - Exonic
1034952647 7:155310742-155310764 CAGCCACGCCGGCTGGCAGCAGG - Intergenic
1035168175 7:157003734-157003756 CAGAAGCAGCTGCTGGGCGCTGG - Intronic
1036699953 8:11006613-11006635 CAGACATGCAGGCTGGGCCCAGG + Intronic
1037904330 8:22706641-22706663 CAGAAGCGCTGACTGTGCGCTGG + Intergenic
1040875915 8:52152097-52152119 CAGAGCAGCAGGCTGGGCGCAGG - Intronic
1041857259 8:62471986-62472008 CTGACACCCAGGCTGGGCGCAGG - Intronic
1044725290 8:95189849-95189871 CAGAAAGGCTGGGTGGGCACTGG - Intergenic
1049505528 8:142994429-142994451 CAGAGAGGCTGGCTGGGCACTGG - Intergenic
1059520309 9:114934505-114934527 CAGAAACTCAGGCTGGGGTCTGG + Intergenic
1061536346 9:131252539-131252561 CAGAGGCGCCGGCTGTGCCCCGG + Intergenic
1062053790 9:134460346-134460368 CAGAAAGGCCAGCTGAGCGAGGG - Intergenic
1062465853 9:136681189-136681211 CAGCACCGCCTGCTGGGCGGGGG - Intronic
1187413165 X:19068968-19068990 CAGAAACGCCAGTTGGGCACTGG + Intronic
1195993145 X:110703167-110703189 CAGAAACTCAGGATGGGGGCTGG + Intronic