ID: 1072916056

View in Genome Browser
Species Human (GRCh38)
Location 10:99537807-99537829
Sequence ACTGGCTCACGCTCGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072916056_1072916062 10 Left 1072916056 10:99537807-99537829 CCCAGAGCCGAGCGTGAGCCAGT No data
Right 1072916062 10:99537840-99537862 GCTGGTCCCGCAGCAACTCGCGG No data
1072916056_1072916063 14 Left 1072916056 10:99537807-99537829 CCCAGAGCCGAGCGTGAGCCAGT No data
Right 1072916063 10:99537844-99537866 GTCCCGCAGCAACTCGCGGCCGG No data
1072916056_1072916064 15 Left 1072916056 10:99537807-99537829 CCCAGAGCCGAGCGTGAGCCAGT No data
Right 1072916064 10:99537845-99537867 TCCCGCAGCAACTCGCGGCCGGG No data
1072916056_1072916059 -8 Left 1072916056 10:99537807-99537829 CCCAGAGCCGAGCGTGAGCCAGT No data
Right 1072916059 10:99537822-99537844 GAGCCAGTGCACCAGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072916056 Original CRISPR ACTGGCTCACGCTCGGCTCT GGG (reversed) Intergenic