ID: 1072924534

View in Genome Browser
Species Human (GRCh38)
Location 10:99604981-99605003
Sequence CTGAGGTTTCCCAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072924528_1072924534 22 Left 1072924528 10:99604936-99604958 CCATAATGGCCGCATCCAATCTG No data
Right 1072924534 10:99604981-99605003 CTGAGGTTTCCCAGAGAAGAAGG No data
1072924530_1072924534 13 Left 1072924530 10:99604945-99604967 CCGCATCCAATCTGTTGAAGGCC 0: 11
1: 198
2: 545
3: 847
4: 1081
Right 1072924534 10:99604981-99605003 CTGAGGTTTCCCAGAGAAGAAGG No data
1072924533_1072924534 -8 Left 1072924533 10:99604966-99604988 CCTTAAAAGCAAAAACTGAGGTT No data
Right 1072924534 10:99604981-99605003 CTGAGGTTTCCCAGAGAAGAAGG No data
1072924531_1072924534 7 Left 1072924531 10:99604951-99604973 CCAATCTGTTGAAGGCCTTAAAA No data
Right 1072924534 10:99604981-99605003 CTGAGGTTTCCCAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072924534 Original CRISPR CTGAGGTTTCCCAGAGAAGA AGG Intergenic
No off target data available for this crispr