ID: 1072924841

View in Genome Browser
Species Human (GRCh38)
Location 10:99608141-99608163
Sequence AGTACCAAGCCATCATCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072924841_1072924846 21 Left 1072924841 10:99608141-99608163 CCACTTGATGATGGCTTGGTACT No data
Right 1072924846 10:99608185-99608207 AACTACCTGGCTCTCCACAGAGG No data
1072924841_1072924845 8 Left 1072924841 10:99608141-99608163 CCACTTGATGATGGCTTGGTACT No data
Right 1072924845 10:99608172-99608194 CAGGTGTCACATGAACTACCTGG No data
1072924841_1072924848 27 Left 1072924841 10:99608141-99608163 CCACTTGATGATGGCTTGGTACT No data
Right 1072924848 10:99608191-99608213 CTGGCTCTCCACAGAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072924841 Original CRISPR AGTACCAAGCCATCATCAAG TGG (reversed) Intergenic