ID: 1072924841 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:99608141-99608163 |
Sequence | AGTACCAAGCCATCATCAAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1072924841_1072924846 | 21 | Left | 1072924841 | 10:99608141-99608163 | CCACTTGATGATGGCTTGGTACT | No data | ||
Right | 1072924846 | 10:99608185-99608207 | AACTACCTGGCTCTCCACAGAGG | No data | ||||
1072924841_1072924845 | 8 | Left | 1072924841 | 10:99608141-99608163 | CCACTTGATGATGGCTTGGTACT | No data | ||
Right | 1072924845 | 10:99608172-99608194 | CAGGTGTCACATGAACTACCTGG | No data | ||||
1072924841_1072924848 | 27 | Left | 1072924841 | 10:99608141-99608163 | CCACTTGATGATGGCTTGGTACT | No data | ||
Right | 1072924848 | 10:99608191-99608213 | CTGGCTCTCCACAGAGGCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1072924841 | Original CRISPR | AGTACCAAGCCATCATCAAG TGG (reversed) | Intergenic | ||