ID: 1072924841 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:99608141-99608163 |
| Sequence | AGTACCAAGCCATCATCAAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072924841_1072924846 | 21 | Left | 1072924841 | 10:99608141-99608163 | CCACTTGATGATGGCTTGGTACT | No data | ||
| Right | 1072924846 | 10:99608185-99608207 | AACTACCTGGCTCTCCACAGAGG | No data | ||||
| 1072924841_1072924845 | 8 | Left | 1072924841 | 10:99608141-99608163 | CCACTTGATGATGGCTTGGTACT | No data | ||
| Right | 1072924845 | 10:99608172-99608194 | CAGGTGTCACATGAACTACCTGG | No data | ||||
| 1072924841_1072924848 | 27 | Left | 1072924841 | 10:99608141-99608163 | CCACTTGATGATGGCTTGGTACT | No data | ||
| Right | 1072924848 | 10:99608191-99608213 | CTGGCTCTCCACAGAGGCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072924841 | Original CRISPR | AGTACCAAGCCATCATCAAG TGG (reversed) | Intergenic | ||